Advertisement

Superantigen-related TH2 CD4+ T cells in nonasthmatic chronic rhinosinusitis with nasal polyps

  • Author Footnotes
    ∗ These authors contributed equally to this work.
    Min-Seok Rha
    Footnotes
    ∗ These authors contributed equally to this work.
    Affiliations
    Graduate School of Medical Science and Engineering, Korea Advanced Institute of Science and Technology, Daejeon, Korea
    Search for articles by this author
  • Author Footnotes
    ∗ These authors contributed equally to this work.
    Sang-Wook Kim
    Footnotes
    ∗ These authors contributed equally to this work.
    Affiliations
    Institute of Health Sciences, Gyeongsang National University, Jinju, Korea

    Department of Otorhinolaryngology, Gyeongsang National University, Jinju, Korea
    Search for articles by this author
  • Author Footnotes
    ∗ These authors contributed equally to this work.
    Dong-Yeop Chang
    Footnotes
    ∗ These authors contributed equally to this work.
    Affiliations
    Graduate School of Medical Science and Engineering, Korea Advanced Institute of Science and Technology, Daejeon, Korea

    Institute of Health Sciences, Gyeongsang National University, Jinju, Korea

    Department of Otorhinolaryngology, Gyeongsang National University, Jinju, Korea
    Search for articles by this author
  • Jin-Ku Lee
    Affiliations
    Department of Biochemistry and Molecular Biology, Ajou University School of Medicine, Suwon, Korea
    Search for articles by this author
  • Jihye Kim
    Affiliations
    BioMedical Science and Engineering Interdisciplinary Program, Korea Advanced Institute of Science and Technology, Daejeon, Korea
    Search for articles by this author
  • Su-Hyung Park
    Affiliations
    Graduate School of Medical Science and Engineering, Korea Advanced Institute of Science and Technology, Daejeon, Korea

    BioMedical Science and Engineering Interdisciplinary Program, Korea Advanced Institute of Science and Technology, Daejeon, Korea
    Search for articles by this author
  • Roza Khalmuratova
    Affiliations
    Obstructive Upper Airway Research Laboratory, Department of Pharmacology, Seoul National University College of Medicine, Seoul, Korea
    Search for articles by this author
  • Hee-Suk Lim
    Affiliations
    Department of Otorhinolaryngology-Head & Neck Surgery, Boramae Medical Center, Seoul National University College of Medicine, Seoul, Korea
    Search for articles by this author
  • Kyoung Mi Eun
    Affiliations
    Department of Otorhinolaryngology-Head & Neck Surgery, Boramae Medical Center, Seoul National University College of Medicine, Seoul, Korea
    Search for articles by this author
  • Seung-No Hong
    Affiliations
    Department of Otorhinolaryngology-Head & Neck Surgery, Boramae Medical Center, Seoul National University College of Medicine, Seoul, Korea
    Search for articles by this author
  • Author Footnotes
    ‡ These authors contributed equally as senior authors.
    Dae Woo Kim
    Correspondence
    Dae Woo Kim, MD, PhD, Department of Otorhinolaryngology-Head & Neck Surgery, Boramae Medical Center, Seoul National University College of Medicine, 425 Shindaebang 2-dong, Dongjak-gu, Seoul 07061, Korea.
    Footnotes
    ‡ These authors contributed equally as senior authors.
    Affiliations
    Department of Otorhinolaryngology-Head & Neck Surgery, Boramae Medical Center, Seoul National University College of Medicine, Seoul, Korea
    Search for articles by this author
  • Author Footnotes
    ‡ These authors contributed equally as senior authors.
    Eui-Cheol Shin
    Correspondence
    Corresponding authors: Eui-Cheol Shin, MD, PhD, Laboratory of Immunology and Infectious Diseases, Graduate School of Medical Science and Engineering, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 34141, Korea.
    Footnotes
    ‡ These authors contributed equally as senior authors.
    Affiliations
    Graduate School of Medical Science and Engineering, Korea Advanced Institute of Science and Technology, Daejeon, Korea

    BioMedical Science and Engineering Interdisciplinary Program, Korea Advanced Institute of Science and Technology, Daejeon, Korea
    Search for articles by this author
  • Author Footnotes
    ∗ These authors contributed equally to this work.
    ‡ These authors contributed equally as senior authors.
Published:January 24, 2020DOI:https://doi.org/10.1016/j.jaci.2019.12.915

      Background

      Staphylococcus aureus enterotoxin (SAE) superantigens are detected in nasal polyps (NPs), and SAE-specific IgE predicts asthma comorbidity in patients with NPs. However, roles of SAE superantigens and superantigen-related T-cell responses remain to be elucidated in nonasthmatic patients.

      Objective

      We investigated the presence of SAEs and SAE-related T-cell receptor (TCR) Vβ (TCRVβ) in nonasthmatic NPs, the phenotypes and functions of SAE-related T cells, and the clinical implication of SAE-related T-cell expansion.

      Methods

      Sinonasal tissue samples were obtained from patients with nonasthmatic chronic rhinosinusitis (CRS) with NPs (CRSwNP), patients with CRS without NPs (CRSsNP), and control subjects. SAE genes were detected by PCR, and the TCRVβ distribution and T-cell phenotypes were examined by flow cytometry.

      Results

      Various SAE genes were detected not only in NPs but also in sinonasal mucosa from patients with CRSsNP and from controls. The S aureus enterotoxin I (SEI) gene was detected in all NPs. The fraction of SEI–responsive TCRVβ+ (TCRVβ1+ and Vβ5.1+) CD4+ T cells was significantly increased only in NPs and the ethmoidal mucosa of patients with CRSwNP, indicating superantigen-induced expansion. The expanded TCRVβ5.1+ CD4+ T cells expressed proliferation marker Ki-67 and the TH2 transcription factor GATA3. Furthermore, TCRVβ5.1+ CD4+ T cells in NPs highly expressed TH2 markers, including IL-17RB, thymic stromal lymphoprotein receptor, and chemoattractant receptor–homologous molecule expressed on TH2 cells, with a potent TH2 cytokine–producing ability. Moreover, the expansion of TCRVβ1+ or Vβ5.1+ CD4+ T cells was associated with the Lund-Mackay computed tomography score, indicating disease extent.

      Conclusion

      In nonasthmatic patients with CRSwNP, superantigen-related expansion of CD4+ T cells with TH2 differentiation was associated with the disease extent.

      Graphical abstract

      Key words

      Abbreviations used:

      CRS (Chronic rhinosinusitis), CRSsNP (Chronic rhinosinusitis without nasal polyps), CRSwNP (Chronic rhinosinusitis with nasal polyps), CRTH2 (Chemoattractant receptor–homologous molecule expressed on TH2 cells), CT (Computed tomography), EM (Ethmoidal mucosa), FACS (Fluorescence-activated cell sorting), NP (Nasal polyp), SAE (Staphylococcus aureus enterotoxin), SAE-IgE (Staphylococcus aureus enterotoxin–specific immunoglobulin E), SEB (Staphylococcus aureus enterotoxin B), SEI (Staphylococcus aureus enterotoxin I), TCRVβ (T-cell receptor variable β-chain), TSLP (Thymic stromal lymphoprotein), TSLPR (Thymic stromal lymphoprotein receptor)
      Chronic rhinosinusitis (CRS) is an inflammatory disease of the nose and paranasal sinuses with symptoms of nasal obstruction, nasal discharge, facial pressure, and/or reduction of smell persisting more than 12 weeks.
      • Fokkens W.J.
      • Lund V.J.
      • Mullol J.
      • Bachert C.
      • Alobid I.
      • Baroody F.
      • et al.
      European Position Paper on Rhinosinusitis and Nasal Polyps 2012.
      ,
      • Schleimer R.P.
      Immunopathogenesis of chronic rhinosinusitis and nasal polyposis.
      Nasal polyps (NPs) are frequently associated with CRS and present as the most severe form of CRS, affecting quality of life. Approximately 2% to 3% of the general population have NPs.
      • Hopkins C.
      Chronic Rhinosinusitis with Nasal Polyps.
      ,
      • We J.
      • Lee W.H.
      • Tan K.L.
      • Wee J.H.
      • Rhee C.S.
      • Lee C.H.
      • et al.
      Prevalence of nasal polyps and its risk factors: Korean National Health and Nutrition Examination Survey 2009-2011.
      However, the exact pathogenesis remains unclear.
      CRS is characterized by a dysfunctional host-environment interaction at the nasal mucosa.
      • Fokkens W.J.
      • Lund V.J.
      • Mullol J.
      • Bachert C.
      • Alobid I.
      • Baroody F.
      • et al.
      European Position Paper on Rhinosinusitis and Nasal Polyps 2012.
      ,
      • Hamilos D.L.
      Host-microbial interactions in patients with chronic rhinosinusitis.
      As a host factor, epithelial damage or genetic defects (barrier defect hypothesis) may lead to increased colonization of bacteria; subsequently, bacterial components invade the mucosa and aggravate the inflammatory reaction.
      • Bose S.
      • Grammer L.C.
      • Peters A.T.
      Infectious chronic rhinosinusitis.
      ,
      • Soyka M.B.
      • Wawrzyniak P.
      • Eiwegger T.
      • Holzmann D.
      • Treis A.
      • Wanke K.
      • et al.
      Defective epithelial barrier in chronic rhinosinusitis: the regulation of tight junctions by IFN-gamma and IL-4.
      As an environmental factor, an increase in colonization with Staphylococcus aureus has been demonstrated in the nasal mucosa of patients with CRS with NPs (CRSwNP) compared with in control subjects or patients with CRS without NPs (CRSsNP).
      • Van Zele T.
      • Gevaert P.
      • Watelet J.B.
      • Claeys G.
      • Holtappels G.
      • Claeys C.
      • et al.
      Staphylococcus aureus colonization and IgE antibody formation to enterotoxins is increased in nasal polyposis.
      In addition, S aureus–derived enterotoxins can act as superantigens, inducing polyclonal stimulation. S aureus enterotoxin (SAE)-specific IgE (SAE-IgE) is detected in almost half of the nasal tissue homogenates from NPs.
      • Bachert C.
      • Gevaert P.
      • Holtappels G.
      • Johansson S.G.
      • van Cauwenberge P.
      Total and specific IgE in nasal polyps is related to local eosinophilic inflammation.
      Staphylococcal superantigens induce nasal polyposis by affecting a variety of cell types, including epithelial cells, lymphocytes, eosinophils, basophils, mast cells, and dendritic cells.
      • Chen J.B.
      • James L.K.
      • Davies A.M.
      • Wu Y.B.
      • Rimmer J.
      • Lund V.J.
      • et al.
      Antibodies and superantibodies in patients with chronic rhinosinusitis with nasal polyps.
      • Muralimohan G.
      • Rossi R.J.
      • Vella A.T.
      Recruitment and in situ renewal regulate rapid accumulation of CD11c+ cells in the lung following intranasal superantigen challenge.
      • Yu R.L.
      • Dong Z.
      Proinflammatory impact of Staphylococcus aureus enterotoxin B on human nasal epithelial cells and inhibition by dexamethasone.
      • Huvenne W.
      • Callebaut I.
      • Reekmans K.
      • Hens G.
      • Bobic S.
      • Jorissen M.
      • et al.
      Staphylococcus aureus enterotoxin B augments granulocyte migration and survival via airway epithelial cell activation.
      • Kim D.W.
      • Khalmuratova R.
      • Hur D.G.
      • Jeon S.Y.
      • Kim S.W.
      • Shin H.W.
      • et al.
      Staphylococcus aureus enterotoxin B contributes to induction of nasal polypoid lesions in an allergic rhinosinusitis murine model.
      • Langier S.
      • Landsberg R.
      • Sade K.
      • Kivity S.
      Anti-IL-5 immunomodulates the effect of Staphylococcus aureus enterotoxin on T cell response in nasal polyps.
      • Teufelberger A.R.
      • Broker B.M.
      • Krysko D.V.
      • Bachert C.
      • Krysko O.
      Staphylococcus aureus orchestrates type 2 airway diseases.
      The net effect of superantigens in NPs is the production of TH2 cytokines, regulatory T-cell inhibition, and accentuated eosinophil and mast cell activity, resulting in tissue damage and remodeling.
      • Kim D.W.
      • Khalmuratova R.
      • Hur D.G.
      • Jeon S.Y.
      • Kim S.W.
      • Shin H.W.
      • et al.
      Staphylococcus aureus enterotoxin B contributes to induction of nasal polypoid lesions in an allergic rhinosinusitis murine model.
      ,
      • Teufelberger A.R.
      • Broker B.M.
      • Krysko D.V.
      • Bachert C.
      • Krysko O.
      Staphylococcus aureus orchestrates type 2 airway diseases.
      • Patou J.
      • Gevaert P.
      • Van Zele T.
      • Holtappels G.
      • van Cauwenberge P.
      • Bachert C.
      Staphylococcus aureus enterotoxin B, protein A, and lipoteichoic acid stimulations in nasal polyps.
      • Wang X.
      • Zhang N.
      • Bo M.
      • Holtappels G.
      • Zheng M.
      • Lou H.
      • et al.
      Diversity of TH cytokine profiles in patients with chronic rhinosinusitis: a multicenter study in Europe, Asia, and Oceania.
      Skewed distribution of T-cell receptor Vβ chain (TCRVβ) has also been reported in NPs as evidence of the pathogenicity of staphylococcal superantigens.
      • Conley D.B.
      • Tripathi A.
      • Seiberling K.A.
      • Schleimer R.P.
      • Suh L.A.
      • Harris K.
      • et al.
      Superantigens and chronic rhinosinusitis: skewing of T-cell receptor V beta-distributions in polyp-derived CD4+ and CD8+ T cells.
      • Bernstein J.M.
      • Allen C.
      • Rich G.
      • Dryja D.
      • Bina P.
      • Reiser R.
      • et al.
      Further observations on the role of Staphylococcus aureus exotoxins and IgE in the pathogenesis of nasal polyposis.
      • Tripathi A.
      • Kern R.
      • Conley D.B.
      • Seiberling K.
      • Klemens J.C.
      • Harris K.E.
      • et al.
      Staphylococcal exotoxins and nasal polyposis: analysis of systemic and local responses.
      Moreover, as a biomarker, SAE-IgE in NPs has been reported to be associated with comorbidities of CRSwNP, such as asthma and aspirin intolerance.
      • Van Zele T.
      • Gevaert P.
      • Watelet J.B.
      • Claeys G.
      • Holtappels G.
      • Claeys C.
      • et al.
      Staphylococcus aureus colonization and IgE antibody formation to enterotoxins is increased in nasal polyposis.
      ,
      • Bachert C.
      • Gevaert P.
      • Holtappels G.
      • Johansson S.G.
      • van Cauwenberge P.
      Total and specific IgE in nasal polyps is related to local eosinophilic inflammation.
      ,
      • Bachert C.
      • Zhang N.
      • Holtappels G.
      • De Lobel L.
      • van Cauwenberge P.
      • Liu S.
      • et al.
      Presence of IL-5 protein and IgE antibodies to staphylococcal enterotoxins in nasal polyps is associated with comorbid asthma.
      However, several issues remain to be answered in the study of staphylococcal superantigens in the pathogenesis of CRSwNP. First, the roles of staphylococcal superantigens remain to be elucidated in nonasthmatic NPs. Second, although several studies have suggested skewed TCRVβ distribution as evidence of the superantigen hypothesis, the association of the presence of SAEs and expansion of the relevant TCRVβ has not been clarified. Third, the phenotypes and functions of superantigen-related expanded T cells and their roles in the extent of disease in NPs are unknown.
      In the present study, we comprehensively examined the presence of various types of staphylococcal superantigens and the expansion of related TCRVβ+ T cells in the NPs of nonasthmatic patients with CRSwNP. In addition, we investigated the immunologic phenotypes and functions of the expanded T cells in detail in the NPs and analyzed their clinical implications in nonasthmatic patients with CRSwNP.

      Methods

      The detailed methods, including additional experimental procedures, are presented in the Methods section in this article’s Online Repository at www.jacionline.org.

       Study subjects

      In all, 20 patients with CRSwNP and 20 patients with CRSsNP were initially enrolled in this study (CRS cohort 1). The diagnosis of CRS and NP was confirmed by nasal endoscopy and computed tomography (CT) scans. Each patient with CRS met the criteria for CRS as defined by the guidelines specified in "EPOS 2012: European Position Paper on Rhinosinusitis and Nasal Polyps 2012."
      • Fokkens W.J.
      • Lund V.J.
      • Mullol J.
      • Bachert C.
      • Alobid I.
      • Baroody F.
      • et al.
      European Position Paper on Rhinosinusitis and Nasal Polyps 2012.
      Patients who had used systemic or nasal topical corticosteroids within a month before tissue collection, had undergone a previous sinonasal surgery, or had aspirin-exacerbated respiratory disease or asthma were excluded. The diagnosis of asthma and aspirin intolerance was based on medical history and physician diagnosis, including the results of a bronchial provocation test. The Lund-Mackay CT scoring system was used to determine disease severity.
      • Lund V.J.
      • Kennedy D.W.
      Quantification for staging sinusitis. The Staging and Therapy Group.
      Samples of the ethmoidal mucosa (EM) and/or NP tissue were obtained during the functional endoscopic sinus surgery. We also obtained NP tissue samples from an independent cohort of patients with CRSwNP (CRS cohort 2) at Boramae Medical Center. This cohort included 30 patients with nonasthmatic CRSwNP. Details of the patients’ characteristics are presented in Table E1 (in the Online Repository available at www.jacionline.org). Inferior turbinate mucosa samples were also obtained from control subjects. Control subjects were patients who underwent septoturbinoplasty to correct a deviated nasal septum and inferior turbinate hypertrophy with no evidence of paranasal sinus problems. This study was reviewed and approved by the institutional review board (26-2016-57) and conducted according to the principles of the Declaration of Helsinki. Informed consent was obtained from all study participants.

       PCR for staphylococcal superantigens

      DNA was extracted from the NPs of patients with CRSwNP (n = 20), EM tissue of patients with CRSsNP (n = 20), and the inferior turbinate mucosa from the control subjects (n = 10) by using the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The extracted DNA was quantified by using NanoDrop2000 (Thermo Scientific, Waltham, Mass). PCR was performed to amplify the staphylococcal superantigen genes by using 10 ng of DNA and 35 cycles of denaturation for 2 minutes at 94°C, annealing for 2 minutes at various temperatures, and extension for 1 minute at 72°C. The oligonucleotide primers for each staphylococcal superantigen gene are summarized in Table E2 (in the Online Repository available at www.jacionline.org).

       Multicolor flow cytometry

      Sinonasal cells were stained with fluorochrome-conjugated antibodies for specific surface markers for 10 minutes at room temperature. Dead cells were excluded by using LIVE/DEAD red fluorescent reactive dye or near-IR fluorescent reactive dye (Invitrogen, Carlsbad, Calif). For intracellular staining, cells were fixed and permeabilized using the Fixation/Permeabilization Buffer Set (eBioscience, San Diego, Calif) according to the manufacturer’s instructions after cell surface staining and were then stained with intracellular markers for 30 minutes at 4°C. Multicolor flow cytometry was performed by using a BD LSR II instrument (BD Biosciences, San Jose, Calif) and FACSDiva software (BD Biosciences). Data were analyzed with FlowJo software (FlowJo LLC, Ashland, Ore).

       TCRVβ typing

      Isolated sinonasal cells from the NPs and EM tissue of patients with CRSwNP, EM tissue of patients with CRSsNP, and inferior turbinate mucosa from the control subjects were used for TCRVβ analysis. Dead cells were stained by using the LIVE/DEAD Fixable Red Dead Cell Stain Kit (Invitrogen) and excluded when flow cytometry data were analyzed. Fluorescein isothiocyanate–, phycoerythrin-, or fluorescein isothiocyanate/phycoerythrin–conjugated antibodies from the IOTest Beta Mark Kit (Beckman Coulter, Inc, Brea, Calif) were used for staining 24 different TCRVβs.

       Calculation of TCRVβ skewing in T cells

      We calculated the average percentage (and SD) of each TCRVβ fraction in CD4+ or CD8+ T cells when we analyzed sinonasal cells isolated from the inferior turbinate mucosa of the control subjects (see Table E3 in the Online Repository available at www.jacionline.org). The degree of skewing of each TCRVβ was calculated by using following equation
      • Bernstein J.M.
      • Allen C.
      • Rich G.
      • Dryja D.
      • Bina P.
      • Reiser R.
      • et al.
      Further observations on the role of Staphylococcus aureus exotoxins and IgE in the pathogenesis of nasal polyposis.
      ,
      • Seiberling K.A.
      • Conley D.B.
      • Tripathi A.
      • Grammer L.C.
      • Shuh L.
      • Haines 3rd, G.K.
      • et al.
      Superantigens and chronic rhinosinusitis: detection of staphylococcal exotoxins in nasal polyps.
      • Callahan J.E.
      • Kappler J.W.
      • Marrack P.
      Unexpected expansions of CD8-bearing cells in old mice.
      • Huang L.
      • Betjes M.G.H.
      • Klepper M.
      • Langerak A.W.
      • Baan C.C.
      • Litjens N.H.R.
      End-stage renal disease causes skewing in the TCR Vbeta-repertoire primarily within CD8(+) T cell subsets.
      :
      Percentage of TCRVβ in patientsAverage of percentage of TCRVβ in the controlsSD of the percentage of TCRVβ in the controls.


       Statistical analysis

      The chi-square test or Fisher exact test was used to analyze differences in the rate of detection of superantigen genes. The Mann-Whitney U test was used to compare data between 2 unpaired groups. The Wilcoxon signed rank test was used to compare data between 2 paired groups. To assess the significance of the correlation, the Pearson correlation test was performed. Statistical analyses were performed by using GraphPad Prism software, version 7 (GraphPad Software, Carlsbad, Calif), or SPSS software, version 22.0 (IBM Corp, Armonk, NY). A P value less than .05 was considered significant. Data are expressed as the means plus or minus SDs.

      Results

       Detection of staphylococcal superantigen genes in sinonasal tissue

      First, we performed PCR for detection of staphylococcal superantigen genes in sinonasal tissues. Various staphylococcal superantigen genes were detected in the NPs of patients with CRSwNP (Table I). However, they were also detected in EM tissue from patients with CRSsNP and inferior turbinate mucosa from control subjects. Among the staphylococcal superantigen genes, S aureus enterotoxin I (SEI) was detected in all of the tested NPs.
      Table ISuperantigens detected in the subjects’ nasal mucosa
      SuperantigenGroup
      CRSwNP (n = 20)CRSsNP (n = 20)Control (n = 10)P value
      Chi-square test or Fisher exact test.
      SEA13 (65%)15 (75%)6 (60%)ns
      SEB16 (80%)17 (85%)7 (70%)ns
      SEC15 (75%)14 (70%)6 (60%)ns
      SED9 (45%)10 (50%)5 (50%)ns
      SEE8 (40%)12 (60%)5 (50%)ns
      SEG18 (90%)15 (75%)7 (70%)ns
      SEH8 (40%)11 (55%)5 (50%)ns
      SEI20 (100%)19 (95%)9 (90%)ns
      TSST-113 (65%)11 (55%)5 (50%)ns
      ns, Not significant; SEA, Staphylococcus aureus enterotoxin A; SEB, Staphylococcus aureus enterotoxin B; SEC, Staphylococcus aureus enterotoxin C; SED, Staphylococcus aureus enterotoxin D; SEE, Staphylococcus aureus enterotoxin E; SEG, Staphylococcus aureus enterotoxin G; SEH, Staphylococcus aureus enterotoxin H; TSST-1, toxic shock syndrome toxin 1.
      Chi-square test or Fisher exact test.

       Skewed TCRVβ distribution in sinonasal CD4+ T cells from patients with CRSwNP

      Next, we examined the distribution of TCRVβs in sinonasal tissues. The fraction of TCRVβ1+ or Vβ5.1+ cells, which are known to be expanded by SEI,
      • Conley D.B.
      • Tripathi A.
      • Seiberling K.A.
      • Schleimer R.P.
      • Suh L.A.
      • Harris K.
      • et al.
      Superantigens and chronic rhinosinusitis: skewing of T-cell receptor V beta-distributions in polyp-derived CD4+ and CD8+ T cells.
      ,
      • Thomas D.
      • Dauwalder O.
      • Brun V.
      • Badiou C.
      • Ferry T.
      • Etienne J.
      • et al.
      Staphylococcus aureus superantigens elicit redundant and extensive human Vbeta patterns.
      was significantly increased in the CD4+ T-cell population of NPs in patients with CRSwNP, although such skewing of the TCRVβ distribution was not found in the CD8+ T-cell population (Fig 1, A). The same was observed in EM tissue from patients with CRSwNP (Fig 1, B). However, the increased fraction of TCRVβ1+ or Vβ5.1+ cells was not observed in the EM tissue of patients with CRSsNP (Fig 1, C). Taken together, we conclude that CD4+ T cells carrying TCRVβ1 and Vβ5.1 are expanded only in the NPs and EM tissue of patients with CRSwNP.
      Figure thumbnail gr1
      Fig 1TCRVβ distribution of T cells from the sinonasal tissues from patients with CRSwNP and patients with CRSsNP. The fraction of each TCRVβ-expressing T cell among CD4+ or CD8+ T-cell population was measured by flow cytometry using cells from NPs (n = 20) (A) or EM tissue (n = 15) of patients with CRSwNP (B) or EM tissue of patients with CRSsNP (n = 20) (C). In addition, inferior turbinate mucosa from control subjects (n = 23) was analyzed for the fraction of TCRVβ-expressing T cells among the CD4+ or CD8+ T-cell population. The degree of skewing of each TCRVβ was calculated as the percentage of TCRVβ in patients minus the average percentage of TCRVβ in the controls divided by the SD of the percentage of TCRVβ in the controls. The mean value for each TCRVβ is presented as a short, blue, horizontal bar. If the skewing degree of each TCRVβ was higher than 2 (dashed red lines), the skewing was considered significant. The data for the significantly skewed TCRVβ are presented as red dots.

       Expression of proliferation marker Ki-67 and antiapoptotic protein Bcl-2 in TCRVβ5.1+ CD4+ T cells from the sinonasal tissue samples from patients with CRSwNP

      We further analyzed TCRVβ5.1+ CD4+ T cells to explore how they expanded in the sinonasal tissue from patients with CRSwNP. Therefore, we examined the expression of Ki-67 (a marker of proliferation) and Bcl-2 (an antiapoptotic protein)
      • Yoshino T.
      • Kondo E.
      • Cao L.
      • Takahashi K.
      • Hayashi K.
      • Nomura S.
      • et al.
      Inverse expression of bcl-2 protein and Fas antigen in lymphoblasts in peripheral lymph nodes and activated peripheral blood T and B lymphocytes.
      • Strasser A.
      • Harris A.W.
      • Huang D.C.
      • Krammer P.H.
      • Cory S.
      Bcl-2 and Fas/APO-1 regulate distinct pathways to lymphocyte apoptosis.
      • Akbar A.N.
      • Borthwick N.
      • Salmon M.
      • Gombert W.
      • Bofill M.
      • Shamsadeen N.
      • et al.
      The significance of low bcl-2 expression by CD45RO T cells in normal individuals and patients with acute viral infections. The role of apoptosis in T cell memory.
      in TCRVβ5.1+ CD4+ T cells from the NPs and EM tissue of patients with CRSwNP and EM tissue of patients with CRSsNP. Representative fluorescence-activated cell sorting (FACS) plots for gating TCRVβ5.1+ CD4+ T cells are presented in Fig 2, A, and representative FACS histograms for Ki-67 and Bcl-2 are presented in Fig 2, B. The frequency of Ki-67+ Bcl-2+ cells in the gate of TCRVβ5.1+ CD4+ T cells was significantly higher in the NPs of patients with CRSwNP than in the EM tissue of patients with CRSwNP or patients with CRSsNP (Fig 2, C). We also found that the frequency of Ki-67+ Bcl-2+ cells was significantly higher among TCRVβ5.1+ CD4+ T cells than among TCRVβ5.1 CD4+ T cells from the NPs of patients with CRSwNP (Fig 2C). Furthermore, the EM tissue of patients with CRSwNP had a higher frequency of Ki-67+ Bcl-2+ cells in the gate of TCRVβ5.1+ CD4+ T cells than did the EM tissue of patients with CRSsNP (Fig 2, C). As expected, the frequency of Ki-67+ Bcl-2+ cells among TCRVβ5.1+ CD4+ T cells significantly correlated with the frequency of TCRVβ5.1+ cells among total CD4+ T cells in the NPs of patients with CRSwNP (Fig 2D).
      Figure thumbnail gr2
      Fig 2Expression of Ki-67 and Bcl-2 in TCRVβ 5.1+ CD4+ T cells from the sinonasal tissue from patients with CRSwNP and patients with CRSsNP. A, Representative FACS plots showing the percentage of TCRVβ5.1+ cells among the total CD4+ T cells in an NP from a patient with CRSwNP and EM tissue from a patient with CRSsNP are presented. B and C, Representative FACS histograms showing the expression of Ki-67 and Bcl-2 in TCRVβ5.1+ and Vβ5.1 CD4+ T cells from NPs are presented (B). The expression of Ki-67 and Bcl-2 was analyzed in TCRVβ5.1+ or Vβ5.1 CD4+ T cells from the NPs (n = 18) and EM tissue (n = 15) of patients with CRSwNP and EM tissue of patients with CRSsNP (n = 18) (C). Horizontal bars and error bars represent means and SDs, respectively. The comparison between TCRVβ5.1+ and Vβ5.1 CD4+ T cells from NPs was performed by using the Wilcoxon signed rank test, and the other comparisons were performed by using the Mann-Whitney U test. D, The frequency of Ki-67+ Bcl-2- cells in TCRVβ5.1+ CD4+ T cells was plotted against the frequency of TCRVβ5.1+ cells among total CD4+ T cells in NPs from patients with CRSwNP (n = 18). The significance of the correlation was tested by using the Pearson correlation test.
      Taken together, these data indicate that TCRVβ5.1+ CD4+ T cells undergo cellular proliferation in the sinonasal tissue from patients with CRSwNP, particularly NPs, and that the expansion of TCRVβ5.1+ CD4+ T cells might be derived from cellular proliferation caused by superantigens.

       TH2 phenotypes of TCRVβ5.1+ CD4+ T cells from NPs

      TH2 inflammation is recognized as being mainly involved in CRSwNP.
      • Cao P.P.
      • Li H.B.
      • Wang B.F.
      • Wang S.B.
      • You X.J.
      • Cui Y.H.
      • et al.
      Distinct immunopathologic characteristics of various types of chronic rhinosinusitis in adult Chinese.
      ,
      • Tomassen P.
      • Vandeplas G.
      • Van Zele T.
      • Cardell L.O.
      • Arebro J.
      • Olze H.
      • et al.
      Inflammatory endotypes of chronic rhinosinusitis based on cluster analysis of biomarkers.
      When we analyzed total CD4+ T cells, expression of the TH2 transcription factor GATA3 was significantly higher in the NPs from patients with CRSwNP than in the EM tissue of patients with CRSsNP (Fig 3, A). As TCRVβ5.1+ CD4+ T cells were expanded in the tissue samples from NPs, we asked whether TCRVβ5.1+ CD4+ T cells deviate to TH2 phenotypes. In the NPs from patients with CRSwNP, TCRVβ5.1+ CD4+ T cells had higher expression of GATA3 than TCRVβ5.1 CD4+ T cells did (Fig 3, B and C). In addition, the frequency of GATA3+ cells among the TCRVβ5.1+ CD4+ T cells was significantly higher in the NPs of patients with CRSwNP than in the EM tissue of patients with CRSsNP (Fig 3, C). However, the expression of T-bet, the TH1 transcription factor, was not different between TCRVβ5.1+ and TCRVβ5.1 CD4+ T cells in NPs from patients with CRSwNP (see Fig E1 in this article’s Online Repository at www.jacionline.org).
      Figure thumbnail gr3
      Fig 3TH2 phenotypes of TCRVβ 5.1+ CD4+ T cells from NPs. A, The expression of GATA3 in total CD4+ T cells was compared between the NPs from patients with CRSwNP (n = 9) and EM tissue of patients with CRSsNP (n = 9). B and C, Representative FACS histogram showing the expression of GATA3 in TCRVβ5.1+ and Vβ5.1 CD4+ T cells from NPs is presented (B). The expression of GATA3 was analyzed in TCRVβ5.1+ or Vβ5.1 CD4+ T cells from the NPs of patients with CRSwNP (n = 9) and EM tissue of patients with CRSsNP (n = 9) (C). D and E, Representative FACS plots showing the expression of IL-17RB, TSLPR, and CRTH2 in TCRVβ5.1+ and Vβ5.1 CD4+ T cells from NPs are presented (D). The expression of IL-17RB (n = 19), TSLPR (n = 18), and CRTH2 (n = 13) was analyzed in TCRVβ 5.1+ and Vβ 5.1 CD4+ T cells from the NPs of patients with CRSwNP (E). F, The expression of IL-17RB, TSLPR, and CRTH2 was analyzed in GATA3+ and GATA3 TCRVβ 5.1+ CD4+ T cells from the NPs of patients with CRSwNP (n = 14). All horizontal bars and error bars represent means and SDs, respectively. Statistical analysis was performed by using the Mann-Whitney U test (A and C) or the Wilcoxon signed rank test (E and F).
      Recent studies have suggested that the IL-25 receptor IL-17RB and thymic stromal lymphoprotein (TSLP) receptor are phenotypic markers of TH2 cells.
      • Lam E.P.
      • Kariyawasam H.H.
      • Rana B.M.
      • Durham S.R.
      • McKenzie A.N.
      • Powell N.
      • et al.
      IL-25/IL-33-responsive TH2 cells characterize nasal polyps with a default TH17 signature in nasal mucosa.
      • Kitajima M.
      • Lee H.C.
      • Nakayama T.
      • Ziegler S.F.
      TSLP enhances the function of helper type 2 cells.
      • Mitson-Salazar A.
      • Yin Y.
      • Wansley D.L.
      • Young M.
      • Bolan H.
      • Arceo S.
      • et al.
      Hematopoietic prostaglandin D synthase defines a proeosinophilic pathogenic effector human T(H)2 cell subpopulation with enhanced function.
      In addition, human TH2 cells can be identified by the expression of the prostaglandin D2 receptor chemoattractant receptor–homologous molecule expressed on TH2 cells (CRTH2).
      • Cosmi L.
      • Annunziato F.
      • Iwasaki M.
      • Galli G.
      • Manetti R.
      • Maggi E.
      • et al.
      CRTH2 is the most reliable marker for the detection of circulating human type 2 Th and type 2 T cytotoxic cells in health and disease.
      ,
      • Cousins D.J.
      Pinning allergies on pathogenic TH2 cells.
      As TCRVβ5.1+ CD4+ T cells exhibited higher expression of GATA3, we investigated the expression of IL-17RB, TSLP receptor (TSLPR), and CRTH2 on TCRVβ5.1+ CD4+ T cells from NPs. The TCRVβ5.1+ CD4+ T cells expressed significantly higher levels of IL-17RB, TSLPR, and CRTH2 than did TCRVβ5.1 CD4+ T cells (Fig 3, D and E), indicating that superantigen-expanded CD4+ T cells are TH2 cells. We also found that TCRVβ5.1+ CD4+ GATA3+ T cells expressed higher levels of IL-17RB, TSLPR, and CRTH2 compared with TCRVβ5.1+ CD4+ GATA3 T cells (Fig 3, F). Altogether, we conclude that CD4+ T cells in NPs, particularly superantigen-expanded TCRVβ5.1+ CD4+ T cells in NPs, deviate toward TH2 status.

       Production of TH2 cytokines by TCRVβ5.1+ CD4+ T cells from NPs

      We further examined the production of TH2 cytokines by CD4+ T cells following anti-CD3 stimulation. The frequency of IL-4+ cells among the total CD4+ T cells was significantly higher in the NPs from patients with CRSwNP than in EM tissue from patients with CRSsNP (Fig 4, A and B). Moreover, we found that TCRVβ5.1+ CD4+ T cells produced significantly higher levels of TH2 cytokines, including IL-4, IL-5, and IL-13, than did TCRVβ5.1 CD4+ cells from the NPs of patients with CRSwNP (Fig 4, C and D and see Fig E2, A in this article’s Online Repository at www.jacionline.org). The same results were observed when sinonasal cells from NPs were stimulated with anti-CD3/CD28 antibodies (see Fig E2, B) or S aureus enterotoxin B (SEB) (see Fig E2, C). Interestingly, the percentage of TCRVβ5.1+ cells among CD4+ T cells positively correlated with the frequency of IL-4+ or IL-13+ cells among TCRVβ5.1+ CD4+ T cells (see Fig E3 in this article’s Online Repository at www.jacionline.org), indicating that TCRVβ5.1+ CD4+ T cells from patients with a higher TCRVβ skewing produce higher levels of TH2 cytokines.
      Figure thumbnail gr4
      Fig 4Production of TH2 cytokines by TCRVβ 5.1+ CD4+ T cells from NPs. AD, Sinonasal cells were stimulated with anti-CD3 antibody for 12 hours. A and B, The percentage of IL-4+ cells among the total CD4+ T cells was analyzed in NPs from patients with CRSwNP (n = 7) and EM tissue from patients with CRSsNP (n = 7). Representative FACS plots (A) and summary data (B) are presented. C and D, The percentage of IL-4+, IL-5+, and IL-13+ cells was analyzed in TCRVβ5.1+ and Vβ5.1 CD4+ T cells from the NPs of patients with CRSwNP (n = 12). Representative FACS plots (C) and summary data (D) are presented. E, The expression of Ki-67 and Bcl-2 was examined in CD4+ T cells from the nasal mucosa of control subjects after stimulation with anti-CD3 antibody for 72 hours in the presence or absence of IL-4. Representative FACS histograms are presented. F, The frequency of TCRVβ5.1+ CD4+ T cells among total CD4+ T cells (left) and the frequency of GATA3+ cells among TCRVβ5.1+ CD4+ T cells (right) were plotted against the frequency of IL-4+ cells among total CD4+ T cells in NPs from patients with CRSwNP (n = 7). All horizontal bars and error bars represent means and SDs, respectively. Statistical analysis was performed by using the Mann-Whitney U test (B), the Wilcoxon signed rank test (D), or the Pearson correlation test (F).
      To investigate the role of TH2 cytokines in the regulation of sinonasal CD4+ T cells, we stimulated CD4+ T cells obtained from the nasal mucosa of control subjects with anti-CD3 in the presence or absence of IL-4 or IL-13. Ki-67 expression increased in the presence of IL-4 or IL-13 (Fig 4, E and see Fig E4 in this article’s Online Repository at www.jacionline.org), suggesting that IL-4 or IL-13 secreted from GATA3+ CD4+ T cells enhances the superantigen-induced proliferation of CD4+ T cells in nasal mucosa. In addition, the frequency of IL-4+ cells among total CD4+ T cells positively correlated with both the frequency of TCRVβ5.1+ cells among total CD4+ T cells and the percentage of GATA3+ cells among TCRVβ5.1+ CD4+ cells in the NPs of patients with CRSwNP (Fig 4, F). These findings suggest positive feedback from TH2 cytokine production to the superantigen-induced proliferation of TH2 cells.
      Recently, dupilumab, a mAb that inhibits signaling by IL-4 and IL-13,
      • Bachert C.
      • Mannent L.
      • Naclerio R.M.
      • Mullol J.
      • Ferguson B.J.
      • Gevaert P.
      • et al.
      Effect of subcutaneous dupilumab on nasal polyp burden in patients with chronic sinusitis and nasal polyposis: a randomized clinical trial.
      ,
      • Bachert C.
      • Han J.K.
      • Desrosiers M.
      • Hellings P.W.
      • Amin N.
      • Lee S.E.
      • et al.
      Efficacy and safety of dupilumab in patients with severe chronic rhinosinusitis with nasal polyps (LIBERTY NP SINUS-24 and LIBERTY NP SINUS-52): results from two multicentre, randomised, double-blind, placebo-controlled, parallel-group phase 3 trials.
      was approved by the US Food and Drug Administration for the treatment of patients with inadequately controlled CRSwNP. Therefore, we investigated the effect of dupilumab on sinonasal CD4+ T cells. Dupilumab inhibited IL-4–induced proliferation and GATA3 upregulation of sinonasal CD4+ T cells (see Fig E5 in this article’s Online Repository at www.jacionline.org). These results indicate that dupilumab may inhibit superantigen-related expansion of pathogenic TH2 cells in patients with nonasthmatic CRSwNP.

       Correlation between the expanded CD4+ T cells and disease extent of CRS

      Finally, we investigated the clinical implication of the expanded TCRVβ1+ and Vβ5.1+ CD4+ T cells. The frequency of TCRVβ5.1+ cells among the total CD4+ T cells from NPs and EM tissue significantly correlated with the Lund-Mackay CT score in patients with CRSwNP (Fig 5, A). This correlation was also observed when TCRVβ1+ cells among CD4+ T cells from NPs were analyzed (Fig 5, B). However, we found no correlation between TCRVβ1+ or Vβ5.1+ cells among total CD4+ T cells from EM tissue and Lund-Mackay CT score in patients with CRSsNP (Fig 5, A and B). In addition, the frequency of TCRVβ2+ cells (which were not expanded in NPs) among the total CD4+ T cells did not correlate with Lund-Mackay CT score in patients with CRSwNP or patients with CRSsNP (Fig 5, C). Taken together, these data indicate that the expansion of superantigen-related CD4+ T cells is directly related to advanced CRS.
      Figure thumbnail gr5
      Fig 5Correlation between the frequency of TCRVβ5.1+ or Vβ1+ CD4+ T cells and Lund-Mackay CT score. AC, Lund-Mackay CT score was plotted against the frequency of TCRVβ5.1+ (A), Vβ1+ (B), or Vβ2+ (C) cells among total CD4+ T cells from the NPs of patients with CRSwNP (n = 20), and the EM tissue of patients with CRSwNP (n = 15) and patients with CRSsNP (n = 20). The significance of the correlation was tested by using the Pearson correlation test.
      Next, we analyzed the relationship between the function of TCRVβ5.1+ CD4+ T cells and eosinophilic inflammation, as evaluated by the number of infiltrated eosinophils in NP tissue. We found a positive correlation between IL-4 production by TCRVβ5.1+ CD4+ T cells and the number of infiltrated eosinophils (see Fig E6 in this article’s Online Repository at www.jacionline.org), suggesting that TCRVβ5.1+ CD4+ T cells directly contribute to eosinophilic inflammation by producing TH2 cytokines.

      Discussion

      S aureus and staphylococcal superantigens are etiologic agents for the development of CRS. Several previous studies have suggested a role of superantigens in CRSwNP by demonstrating a skewed TCRVβ distribution of T cells.
      • Conley D.B.
      • Tripathi A.
      • Seiberling K.A.
      • Schleimer R.P.
      • Suh L.A.
      • Harris K.
      • et al.
      Superantigens and chronic rhinosinusitis: skewing of T-cell receptor V beta-distributions in polyp-derived CD4+ and CD8+ T cells.
      • Bernstein J.M.
      • Allen C.
      • Rich G.
      • Dryja D.
      • Bina P.
      • Reiser R.
      • et al.
      Further observations on the role of Staphylococcus aureus exotoxins and IgE in the pathogenesis of nasal polyposis.
      • Tripathi A.
      • Kern R.
      • Conley D.B.
      • Seiberling K.
      • Klemens J.C.
      • Harris K.E.
      • et al.
      Staphylococcal exotoxins and nasal polyposis: analysis of systemic and local responses.
      In addition, SEB stimulation of nasal tissue explants induces the production of TH2 cytokines.
      • Patou J.
      • Gevaert P.
      • Van Zele T.
      • Holtappels G.
      • van Cauwenberge P.
      • Bachert C.
      Staphylococcus aureus enterotoxin B, protein A, and lipoteichoic acid stimulations in nasal polyps.
      ,
      • Okano M.
      • Fujiwara T.
      • Haruna T.
      • Kariya S.
      • Makihara S.
      • Higaki T.
      • et al.
      Role of fungal antigens in eosinophilia-associated cellular responses in nasal polyps: a comparison with enterotoxin.
      However, the exact mechanism underlying the effect of staphylococcal superantigens on TH2 inflammation in CRSwNP is unclear. Here, we demonstrated that CD4+ T cells with superantigen-related expansion exhibit TH2 phenotypes with proliferative features in nonasthmatic CRSwNP. Moreover, given that the expansion of TCRVβ5.1+ CD4+ T cells significantly correlated with disease extent in CRSwNP, we conclude that these expanded CD4+ T cells play a critical role in type 2 inflammation and may be regulatory targets for the management of CRSwNP.
      In the present study, we examined TCRVβ distribution not only in NPs from patients with CRSwNP but also in EM tissue from patients with CRSwNP and patients with CRSsNP. To the best of our knowledge, this is the first study to comprehensively analyze TCRVβ distribution by examining both NPs and nonpolyp EM tissue. Interestingly, superantigen-related expansion of T cells occurred not only in NPs but also in the EM tissue of patients with CRSwNP, and not in the EM tissue of patients with CRSsNP. These data indicate that superantigen-related expansion of T cells is observed only in patients with CRSwNP, but NPs do not necessarily develop in the sinonasal tissue with superantigen-related expansion of T cells. Factors driving polypogenesis in the presence of superantigen-related T-cell expansion need to be investigated in future studies.
      Consistent with several prior studies,
      • Van Zele T.
      • Gevaert P.
      • Watelet J.B.
      • Claeys G.
      • Holtappels G.
      • Claeys C.
      • et al.
      Staphylococcus aureus colonization and IgE antibody formation to enterotoxins is increased in nasal polyposis.
      ,
      • Seiberling K.A.
      • Conley D.B.
      • Tripathi A.
      • Grammer L.C.
      • Shuh L.
      • Haines 3rd, G.K.
      • et al.
      Superantigens and chronic rhinosinusitis: detection of staphylococcal exotoxins in nasal polyps.
      ,
      • el-Fiky L.M.
      • Khamis N.
      • Mostafa Bel D.
      • Adly A.M.
      Staphylococcal infection and toxin production in chronic rhinosinusitis.
      ,
      • Van Zele T.
      • Vaneechoutte M.
      • Holtappels G.
      • Gevaert P.
      • van Cauwenberge P.
      • Bachert C.
      Detection of enterotoxin DNA in Staphylococcus aureus strains obtained from the middle meatus in controls and nasal polyp patients.
      we found that various SAE genes were detected not only in NPs but also in the sinonasal mucosa from patients with CRSsNP and control subjects. Intriguingly, SEI gene was detected in all NPs we studied. Among diverse superantigen-associated TCRVβ types, TCRVβ1+ and Vβ5.1+ CD4+ T cells are expanded by S aureus enterotoxin D and SEI.
      • Conley D.B.
      • Tripathi A.
      • Seiberling K.A.
      • Schleimer R.P.
      • Suh L.A.
      • Harris K.
      • et al.
      Superantigens and chronic rhinosinusitis: skewing of T-cell receptor V beta-distributions in polyp-derived CD4+ and CD8+ T cells.
      ,
      • Thomas D.
      • Dauwalder O.
      • Brun V.
      • Badiou C.
      • Ferry T.
      • Etienne J.
      • et al.
      Staphylococcus aureus superantigens elicit redundant and extensive human Vbeta patterns.
      Considering that S aureus enterotoxin D and SEI were, respectively, detected in 45% and 100% of the tested NPs, we conclude that SEI could be a major superantigen driving the expansion of TCRVβ1+ or Vβ5.1+ CD4+ T cells. However, skewed TCRVβ distribution was not observed in the sinonasal mucosa of control subjects and patients with CRSsNP, although superantigen genes were present in all subjects. Further studies are required to clarify which factors determine superantigen-related T-cell expansion and subsequent skewing of the TCRVβ distribution in the presence of superantigens in the sinonasal mucosa.
      In the current study, the expanded TCRVβ5.1+ CD4+ T cells in NPs expressed GATA3 rather than T-bet. In addition, TCRVβ5.1+ CD4+ T cells expressed higher levels of several phenotypic markers, including IL-17RB, TSLPR, and CRTH2, which have been proposed to identify TH2 cells. There is mounting evidence that epithelial-derived cytokines, including IL-25 and TSLP, play critical roles in the pathogenesis of CRSwNP.
      • Shin H.W.
      • Kim D.K.
      • Park M.H.
      • Eun K.M.
      • Lee M.
      • So D.
      • et al.
      IL-25 as a novel therapeutic target in nasal polyps of patients with chronic rhinosinusitis.
      ,
      • Nagarkar D.R.
      • Poposki J.A.
      • Tan B.K.
      • Comeau M.R.
      • Peters A.T.
      • Hulse K.E.
      • et al.
      Thymic stromal lymphopoietin activity is increased in nasal polyps of patients with chronic rhinosinusitis.
      IL-25 has been suggested to enhance TH2 cytokine production by activated TH2 memory cells,
      • Wang Y.H.
      • Angkasekwinai P.
      • Lu N.
      • Voo K.S.
      • Arima K.
      • Hanabuchi S.
      • et al.
      IL-25 augments type 2 immune responses by enhancing the expansion and functions of TSLP-DC-activated Th2 memory cells.
      and TSLP signaling in T cells drives pathogenic TH2 responses.
      • Rochman Y.
      • Dienger-Stambaugh K.
      • Richgels P.K.
      • Lewkowich I.P.
      • Kartashov A.V.
      • Barski A.
      • et al.
      TSLP signaling in CD4(+) T cells programs a pathogenic T helper 2 cell state.
      The IL-17RB+ CD4+ T cells represented TH2 cells in CRSwNP,
      • Lam E.P.
      • Kariyawasam H.H.
      • Rana B.M.
      • Durham S.R.
      • McKenzie A.N.
      • Powell N.
      • et al.
      IL-25/IL-33-responsive TH2 cells characterize nasal polyps with a default TH17 signature in nasal mucosa.
      and TSLPR was highly expressed on activated TH2 cells.
      • Kitajima M.
      • Lee H.C.
      • Nakayama T.
      • Ziegler S.F.
      TSLP enhances the function of helper type 2 cells.
      ,
      • Mitson-Salazar A.
      • Yin Y.
      • Wansley D.L.
      • Young M.
      • Bolan H.
      • Arceo S.
      • et al.
      Hematopoietic prostaglandin D synthase defines a proeosinophilic pathogenic effector human T(H)2 cell subpopulation with enhanced function.
      Our current findings indicate that superantigen-related expanded CD4+ T cells in NPs are TH2 cells and can further respond to epithelial-derived cytokines that intensify TH2 inflammation.
      TCRVβ5.1+ CD4+ T cells in NPs have a potent ability to produce TH2 cytokines in the functional analysis, consistent with high expression of GATA3. Previous studies have shown superantigen-induced production of TH2 cytokines, such as IL-4 and IL-5,
      • Yu R.L.
      • Dong Z.
      Proinflammatory impact of Staphylococcus aureus enterotoxin B on human nasal epithelial cells and inhibition by dexamethasone.
      ,
      • Kim D.W.
      • Khalmuratova R.
      • Hur D.G.
      • Jeon S.Y.
      • Kim S.W.
      • Shin H.W.
      • et al.
      Staphylococcus aureus enterotoxin B contributes to induction of nasal polypoid lesions in an allergic rhinosinusitis murine model.
      ,
      • Langier S.
      • Landsberg R.
      • Sade K.
      • Kivity S.
      Anti-IL-5 immunomodulates the effect of Staphylococcus aureus enterotoxin on T cell response in nasal polyps.
      ,
      • Patou J.
      • Gevaert P.
      • Van Zele T.
      • Holtappels G.
      • van Cauwenberge P.
      • Bachert C.
      Staphylococcus aureus enterotoxin B, protein A, and lipoteichoic acid stimulations in nasal polyps.
      ,
      • Huvenne W.
      • Callebaut I.
      • Plantinga M.
      • Vanoirbeek J.A.
      • Krysko O.
      • Bullens D.M.
      • et al.
      Staphylococcus aureus enterotoxin B facilitates allergic sensitization in experimental asthma.
      which augment the activation and proliferation of TH2 cells. In the present study, IL-4 or IL-13 treatment in addition to anti-CD3 stimulation resulted in stronger expression of Ki-67 in sinonasal CD4+ T cells from control subjects than did anti-CD3 simulation alone. In addition, IL-4 is known to inhibit activation-induced cell death of superantigen-activated CD4+ T cells.
      • Lin Y.T.
      • Wang C.T.
      • Hsu C.T.
      • Wang L.F.
      • Shau W.Y.
      • Yang Y.H.
      • et al.
      Differential susceptibility to staphylococcal superantigen (SsAg)-induced apoptosis of CD4+ T cells from atopic dermatitis patients and healthy subjects: the inhibitory effect of IL-4 on SsAg-induced apoptosis.
      ,
      • Lin Y.T.
      • Wang C.T.
      • Lee J.H.
      • Chu C.Y.
      • Tsao W.C.
      • Yang Y.H.
      • et al.
      Higher Bcl-2 levels decrease staphylococcal superantigen-induced apoptosis of CD4+ T cells in atopic dermatitis.
      Furthermore, we found that the percentage of TCRVβ5.1+ cells among CD4+ T cells positively correlated with the production of IL-4 or IL-13 by TCRVβ5.1+ CD4+ T cells. Thus, superantigen-induced T-cell proliferation with TH2 differentiation results in the production of TH2 cytokines, and TH2 cytokines further contribute to the proliferation and survival of superantigen-expanded T cells.
      In a previous randomized clinical trial, dupilumab improved the Lund-Mackay CT score, University of Pennsylvania Smell Identification Test score, and Sino-nasal Outcomes Test (SNOT-22) total score in nonasthmatic patients with CRSwNP .
      • Bachert C.
      • Mannent L.
      • Naclerio R.M.
      • Mullol J.
      • Ferguson B.J.
      • Gevaert P.
      • et al.
      Effect of subcutaneous dupilumab on nasal polyp burden in patients with chronic sinusitis and nasal polyposis: a randomized clinical trial.
      In line with the previous report, we found that dupilumab inhibited IL-4–induced proliferation and GATA3 upregulation of sinonasal CD4+ T cells. These results suggest that dupilumab may inhibit superantigen-related expansion of pathogenic TH2 cells in nonasthmatic CRSwNP, potentially explaining 1 of the possible mechanisms of the beneficial effect of dupilumab on patients with nonasthmatic CRSwNP.
      In the current study, we included only subjects without asthma and characterized superantigen-related expanded CD4+ T cells in patients with nonasthmatic CRSwNP, which explains 67% to 99% of total CRSwNP cases in East Asia.
      • We J.
      • Lee W.H.
      • Tan K.L.
      • Wee J.H.
      • Rhee C.S.
      • Lee C.H.
      • et al.
      Prevalence of nasal polyps and its risk factors: Korean National Health and Nutrition Examination Survey 2009-2011.
      ,
      • Wang X.
      • Zhang N.
      • Bo M.
      • Holtappels G.
      • Zheng M.
      • Lou H.
      • et al.
      Diversity of TH cytokine profiles in patients with chronic rhinosinusitis: a multicenter study in Europe, Asia, and Oceania.
      ,
      • Cao P.P.
      • Li H.B.
      • Wang B.F.
      • Wang S.B.
      • You X.J.
      • Cui Y.H.
      • et al.
      Distinct immunopathologic characteristics of various types of chronic rhinosinusitis in adult Chinese.
      Staphylococcal superantigens are considered to be closely associated with asthmatic CRSwNP because an increased level of SAE-IgE is associated with asthma comorbidity in CRSwNP,
      • Van Zele T.
      • Gevaert P.
      • Watelet J.B.
      • Claeys G.
      • Holtappels G.
      • Claeys C.
      • et al.
      Staphylococcus aureus colonization and IgE antibody formation to enterotoxins is increased in nasal polyposis.
      and SAE-IgE positivity is significantly greater in patients with severe asthma than in control subjects.
      • Bachert C.
      • van Steen K.
      • Zhang N.
      • Holtappels G.
      • Cattaert T.
      • Maus B.
      • et al.
      Specific IgE against Staphylococcus aureus enterotoxins: an independent risk factor for asthma.
      However, the immunologic characteristics of CD4+ T cells from asthmatic NPs have not been well defined. The TCRVβ distribution and phenotypes of superantigen-related expanded T cells in asthmatic NPs may differ from our current results in nonasthmatic NPs. Thus, it would be interesting to investigate the differences in superantigen-related pathogenesis between asthmatic and nonasthmatic CRSwNP.
      In summary, although the presence of SAE genes was not different between groups, the TCRVβ distribution was skewed in sinonasal tissues from nonasthmatic patients with CRSwNP. In particular, TCRVβ1+ and Vβ5.1+ CD4+ T cells were significantly increased in sinonasal tissues from patients with CRSwNP. Furthermore, they had significantly higher proliferative and TH2-deviated features. The frequency of these expanded CD4+ T cells significantly correlated with the Lund-Mackay CT score, indicating disease extent, in nonasthmatic patients with CRSwNP. These findings significantly advance our understanding of superantigen-related pathogenesis of nonasthmatic CRSwNP and suggest opportunities for novel therapeutic intervention.
      Clinical implications
      Superantigen-related expansion of CD4+ T cells with TH2 differentiation is associated with the extent of disease in nonasthmatic patients with CRSwNP.

      Methods

       Sinonasal cell isolation

      Harvested tissue from the NPs or EM during functional endoscopic sinus surgery were minced into small pieces and then mechanically homogenized. The homogenates were filtered by using a 70-μm cell strainer (SPL Lifesciences, Pocheon, Korea), and the filtered cells were collected.

       Flow cytometry antibodies

      Multicolor flow cytometry was performed by using the following fluorochrome-conjugated antibodies: V500-conjugated anti-CD3 (UCHT1), allophycocyanin (APC)-H7–conjugated anti-CD4 (RPA-T4), APC-H7–conjugated anti-CD8 (SK1), Alexa-Fluor 647–conjugated anti–Ki-67 (B56), phycoerythrin (PE)- or V450-conjugated anti–Bcl-2 (Bcl-2/100), BV421- or PE-Cy7–conjugated anti-GATA3 (L50-823), Alexa-Fluor 647–conjugated anti–T-bet (4B10), APC-conjugated anti–IFN-γ (B27), APC-conjugated anti–IL-5 (TRFK5), and BV510-conjugated anti-TSLPR (1F11/TSLPR) from BD Biosciences; PE-conjugated anti–IL-4 (7A3-3) and PE-Vio770–conjugated anti-TCRVβ5.1 (REA1062) from Miltenyi Biotec (Bergisch Gladbach, Germany); Alexa-Fluor 488–conjugated anti–IL-13 (eBio13A) from eBioscience; PerCP-Cy5.5–conjugated anti-CRTH2 (BM16) from BioLegend (San Diego, Calif); and PE-conjugated anti–IL-17RB (FAB1207P) from R&D Systems (Minneapolis, Minn).

       In vitro stimulation of sinonasal T cells

      For intracellular cytokine staining (ICS), cells were stimulated with anti-CD3 antibody (0.1 μg/mL; OKT3, BD Biosciences) or anti-CD3 (0.1 μg/mL)/CD28 (1 mg/mL; CD28.2, BD Biosciences) antibodies for 12 hours. One hour after stimulation, Brefeldin A (BD Biosciences) was added and the cells were incubated for another 11 hours. In some experiments, sinonasal cells were stimulated with SEB (100 ng/mL; Sigma-Aldrich, St Louis, Mo) for 24 hours and Brefeldin A added for the last 5 hours. After incubation, cells were harvested and subjected to ICS. When ICS was performed in combination with TCRVβ5.1 staining, PE-Vio770–conjugated anti-TCRVβ5.1 antibody (REA1062; Miltenyi Biotec) was used for staining compatibility. To examine the effect of IL-4 and IL-13 on Ki-67 expression, cells from the nasal mucosa of control subjects were cultured in the presence or absence of recombinant human IL-4 (10 ng/mL; PeproTech, Rocky Hill, NJ) or IL-13 (10 ng/mL; PeproTech) for 24 hours. Next, anti-CD3 antibody (0.1 μg/mL) was added, after which the culture was incubated for 72 hours and then Ki-67–stained as we have already described. To investigate the effect of dupilumab, sinonasal cells were treated with dupilumab (100 nM; Creative Biolabs, Shirley, NY) in combination with anti-CD3/CD28 antibodies and IL-4.
      Figure thumbnail fx2
      Fig E1T-bet expression in TCRVβ5.1+ and Vβ5.1 CD4+ T cells from NPs. Representative FACS histogram showing the expression of T-bet in TCRVβ5.1+ and Vβ5.1 CD4+ T cells from the NPs of patients with CRSwNP is presented.
      Figure thumbnail fx3
      Fig E2Production of TH2 cytokines by TCRVβ 5.1+ CD4+ T cells from NPs. AC, Sinonasal cells from the NPs of patients with CRSwNP (n = 30) in CRS cohort 2 were stimulated with anti-CD3 antibody (A), anti-CD3/CD28 antibodies (B), or SEB (C). A and B, Following stimulation, sinonasal cells were incubated for 12 hours and ICS was performed to examine the percentage of IL-4+, IL-5+, and IL-13+ cells among TCRVβ5.1+ and Vβ5.1 CD4+ T cells. C, Following stimulation, sinonasal cells were incubated for 24 hours and ICS was performed to examine the percentage of IL-4+, IL-5+, and IL-13+ cells in TCRVβ5.1+ and Vβ5.1 CD4+ T cells. Representative FACS plots and summary data are presented. Statistical analysis was performed by using the Wilcoxon signed rank test.
      Figure thumbnail fx4
      Fig E3Correlation between the frequency of TCRVβ5.1+ CD4+ T cells and production of TH2 cytokines by TCRVβ 5.1+ CD4+ T cells. Sinonasal cells from the NPs of patients with CRSwNP (n = 30) in CRS cohort 2 were stimulated with anti-CD3 antibody for 12 hours. The percentages of IL-4+, IL-5+, and IL-13+ cells among TCRVβ5.1+ CD4+ T cells were plotted against the frequency of TCRVβ5.1+ cells among the total CD4+ T cells from the NPs of patients with CRSwNP. The significance of the correlation was tested by using the Pearson correlation test.
      Figure thumbnail fx5
      Fig E4The effect of IL-13 on the expression of Ki-67 and Bcl-2 in sinonasal CD4+ T cells. The expression of Ki-67 and Bcl-2 was examined in CD4+ T cells from the nasal mucosa of control subjects (n = 3) after stimulation with anti-CD3 antibody for 72 hours in the presence or absence of IL-13. Representative FACS histograms are presented.
      Figure thumbnail fx6
      Fig E5The effect of dupilumab on IL-4–induced proliferation and GATA3 upregulation of sinonasal CD4+ T cells. The expression of Ki-67 and GATA3 was examined in CD4+ T cells from the nasal mucosa of control subjects (n = 3) after stimulation with anti-CD3/CD28 antibodies for 72 hours in the presence or absence of IL-4 or dupilumab. Representative FACS plots are presented.
      Figure thumbnail fx7
      Fig E6Correlation between the production of IL-4 by TCRVβ 5.1+ CD4+ T cells and the number of eosinophils infiltrating NPs. Sinonasal cells from the NPs of patients with CRSwNP (n = 30) in CRS cohort 2 were stimulated with anti-CD3 antibody for 12 hours. The number of infiltrated eosinophils was plotted against the percentage of IL-4+ cells among TCRVβ5.1+ CD4+ T cells from the NPs of patients with CRSwNP. The significance of the correlation was tested by using the Pearson correlation test.
      Table E1Characteristics of the study subjects
      CharacteristicsCRS cohort 1CRS cohort 2
      CRSwNPCRSsNPCRSwNP
      No. of subjects202030
      Age, y46.0 ± 10.841.5 ± 12.947.0 ± 14.9
      Males/females15/516/422/8
      CT score
      Evaluated by the Lund-Mackay scoring system.
      13.8 ± 5.310.6 ± 4.515.4 ± 5.6
      Atopy
      Number of subjects with positive atopy results.
      6510
      Asthma
      Number of subjects with asthma.
      000
      Eosinophil, %
      Fraction of eosinophils among the peripheral white blood cells.
      6.8 ± 1.25.1 ± 1.05.4 ± 3.5
      CT, Computed tomography.
      Data are presented as means plus or minus SDs unless otherwise noted.
      Evaluated by the Lund-Mackay scoring system.
      Number of subjects with positive atopy results.
      Number of subjects with asthma.
      § Fraction of eosinophils among the peripheral white blood cells.
      Table E2PCR primers for superantigen detection
      Gene
      The sequences and locations are from the published data for SEA, SEB, SEC, SED, SEE, and TSST-1E1 and for SEG, SEH, and SEI.E2
      PrimerOligonucleotide sequence (5'-3')Location within gene
      Given in nucleotide numbers.
      Size of amplified product (bp)Annealing temperature (°C)
      SEAForwardTTGGAAACGGTTAAAACGAA490-50912057
      ReverseGAACCTTCCCATCAAAAACA591-610
      SEBForwardTCGCATCAAACTGACAAACG634-65347860
      ReverseGCAGGTACTCTATAAGTGCC1091-1110
      SECForwardGACATAAAAGCTAGGAATTT676-69525757
      ReverseAAATCGGATTAACATTATCC913-932
      SEDForwardCTAGTTTGGTAATATCTCCT354-37331757
      ReverseTAATGCTATATCTTATAGGG652-671
      SEEForwardTAGATAAAGTTAAAACAAGC491-51017057
      ReverseTAACTTACCGTGGACCCTTC640-659
      TSST-1ForwardATGGCAGCATCAGCTTGATA251-27035057
      ReverseTTTCCAATAACCACCCGTTT581-600
      SEGForwardGCTATCGACACACTACAACC62-8158360
      ReverseCCAAGTGATTGTCTATTGTCG624-644
      SEHForwardCACATCATATGCGAAAGC261-27854860
      ReverseCGAATGAGTAATCTCTAGG790-808
      SEIForwardGATACTGGAACAGGACAAGC6-2578962
      ReverseCTTACAG GCAGTCCATCTCC775-794
      SEA, Staphylococcus aureus enterotoxin A; SEB, Staphylococcus aureus enterotoxin B; SEC, Staphylococcus aureus enterotoxin C; SED, Staphylococcus aureus enterotoxin D; SEE, Staphylococcus aureus enterotoxin E; SEG, Staphylococcus aureus enterotoxin G; SEH, Staphylococcus aureus enterotoxin H; TSST-1, toxic shock syndrome toxin 1.
      The sequences and locations are from the published data for SEA, SEB, SEC, SED, SEE, and TSST-1E1 and for SEG, SEH, and SEI.E2
      Given in nucleotide numbers.
      Table E3TCRVβ chain usage in CD4+ T cells from the nasal mucosa of control subjects
      SubjectVβ (%)
      12345.15.25.37.17.289111213.113.213.6141617182021.32223
      C013.812.14.60.08.85.22.80.00.07.51.80.00.06.01.51.52.73.57.06.65.58.31.43.0
      C025.74.23.15.39.11.73.17.61.42.63.11.31.96.32.27.41.22.78.33.01.11.27.23.3
      C031.318.810.81.54.70.00.40.81.51.72.10.81.35.56.61.11.52.12.52.42.44.02.32.7
      C040.011.18.31.55.35.61.73.37.42.26.13.75.62.02.71.60.36.13.01.43.16.77.40.0
      C051.89.24.74.212.83.32.35.73.08.50.55.30.01.01.02.26.13.19.02.81.80.01.80.0
      C062.98.81.31.89.32.21.78.25.44.80.86.71.23.33.12.23.42.08.34.32.01.21.23.2
      C071.96.73.01.56.80.40.91.20.93.44.20.41.55.05.42.94.13.215.52.01.61.15.52.4
      C083.16.26.52.18.30.51.51.00.05.92.80.41.62.71.41.62.93.25.11.48.31.03.72.5
      C092.110.45.26.72.81.22.21.42.38.23.23.11.01.42.92.61.11.98.83.37.70.91.91.5
      C103.111.31.40.09.00.91.72.41.43.81.12.38.73.82.77.65.40.02.85.53.94.61.53.1
      C111.07.92.60.25.11.71.35.30.53.00.83.55.65.65.75.71.62.06.21.62.13.44.61.8
      C121.511.41.61.77.03.33.23.81.12.82.21.82.63.07.23.72.20.88.90.91.04.12.23.2
      C132.76.84.03.92.64.24.27.82.21.10.33.44.41.93.32.03.74.63.61.22.61.96.10.2
      C140.210.14.38.76.71.11.22.91.22.71.91.35.62.43.02.54.23.37.43.71.32.22.40.9
      C151.95.89.23.98.30.61.83.90.31.84.50.91.15.01.51.25.11.310.61.24.11.81.11.2
      C162.39.68.21.63.44.02.20.43.43.00.71.32.93.83.23.82.30.74.66.03.10.82.13.4
      C171.910.34.51.25.41.83.22.10.95.92.03.47.82.04.42.81.23.83.84.81.90.91.91.0
      C183.09.53.10.93.32.22.34.91.17.64.74.22.33.62.23.53.62.45.27.20.72.43.40.9
      C192.615.46.80.61.13.21.92.23.64.62.91.81.61.94.72.31.22.88.13.21.93.72.62.1
      C205.67.35.62.22.70.83.04.52.32.01.30.62.21.05.13.63.42.613.32.05.81.40.81.1
      C211.79.63.81.21.21.91.25.62.13.52.71.13.42.13.11.93.56.110.04.92.30.32.41.8
      C220.58.17.25.23.14.80.95.03.22.01.72.34.64.52.83.32.95.35.82.21.30.73.34.5
      C230.612.41.91.38.81.92.63.60.62.55.61.12.25.24.52.31.43.47.73.63.42.12.21.9
      Mean2.29.74.82.55.92.32.03.62.04.02.52.23.03.43.53.02.82.97.23.33.02.43.02.0
      SD1.53.22.62.33.11.60.92.41.82.21.61.72.31.71.71.81.51.63.31.92.12.11.91.2

      References

        • Fokkens W.J.
        • Lund V.J.
        • Mullol J.
        • Bachert C.
        • Alobid I.
        • Baroody F.
        • et al.
        European Position Paper on Rhinosinusitis and Nasal Polyps 2012.
        Rhinol Suppl. 2012; 23: 1-298
        • Schleimer R.P.
        Immunopathogenesis of chronic rhinosinusitis and nasal polyposis.
        Annu Rev Pathol. 2017; 12: 331-357
        • Hopkins C.
        Chronic Rhinosinusitis with Nasal Polyps.
        N Engl J Med. 2019; 381: 55-63
        • We J.
        • Lee W.H.
        • Tan K.L.
        • Wee J.H.
        • Rhee C.S.
        • Lee C.H.
        • et al.
        Prevalence of nasal polyps and its risk factors: Korean National Health and Nutrition Examination Survey 2009-2011.
        Am J Rhinol Allergy. 2015; 29: e24-e28
        • Hamilos D.L.
        Host-microbial interactions in patients with chronic rhinosinusitis.
        J Allergy Clin Immunol. 2014; 133: 640-653.e4
        • Bose S.
        • Grammer L.C.
        • Peters A.T.
        Infectious chronic rhinosinusitis.
        J Allergy Clin Immunol Pract. 2016; 4: 584-589
        • Soyka M.B.
        • Wawrzyniak P.
        • Eiwegger T.
        • Holzmann D.
        • Treis A.
        • Wanke K.
        • et al.
        Defective epithelial barrier in chronic rhinosinusitis: the regulation of tight junctions by IFN-gamma and IL-4.
        J Allergy Clin Immunol. 2012; 130: 1087-1096.e10
        • Van Zele T.
        • Gevaert P.
        • Watelet J.B.
        • Claeys G.
        • Holtappels G.
        • Claeys C.
        • et al.
        Staphylococcus aureus colonization and IgE antibody formation to enterotoxins is increased in nasal polyposis.
        J Allergy Clin Immunol. 2004; 114: 981-983
        • Bachert C.
        • Gevaert P.
        • Holtappels G.
        • Johansson S.G.
        • van Cauwenberge P.
        Total and specific IgE in nasal polyps is related to local eosinophilic inflammation.
        J Allergy Clin Immunol. 2001; 107: 607-614
        • Chen J.B.
        • James L.K.
        • Davies A.M.
        • Wu Y.B.
        • Rimmer J.
        • Lund V.J.
        • et al.
        Antibodies and superantibodies in patients with chronic rhinosinusitis with nasal polyps.
        J Allergy Clin Immunol. 2017; 139: 1195-1204.e11
        • Muralimohan G.
        • Rossi R.J.
        • Vella A.T.
        Recruitment and in situ renewal regulate rapid accumulation of CD11c+ cells in the lung following intranasal superantigen challenge.
        Int Arch Allergy Immunol. 2008; 147: 59-73
        • Yu R.L.
        • Dong Z.
        Proinflammatory impact of Staphylococcus aureus enterotoxin B on human nasal epithelial cells and inhibition by dexamethasone.
        Am J Rhinol Allergy. 2009; 23: 15-20
        • Huvenne W.
        • Callebaut I.
        • Reekmans K.
        • Hens G.
        • Bobic S.
        • Jorissen M.
        • et al.
        Staphylococcus aureus enterotoxin B augments granulocyte migration and survival via airway epithelial cell activation.
        Allergy. 2010; 65: 1013-1020
        • Kim D.W.
        • Khalmuratova R.
        • Hur D.G.
        • Jeon S.Y.
        • Kim S.W.
        • Shin H.W.
        • et al.
        Staphylococcus aureus enterotoxin B contributes to induction of nasal polypoid lesions in an allergic rhinosinusitis murine model.
        Am J Rhinol Allergy. 2011; 25: e255-e261
        • Langier S.
        • Landsberg R.
        • Sade K.
        • Kivity S.
        Anti-IL-5 immunomodulates the effect of Staphylococcus aureus enterotoxin on T cell response in nasal polyps.
        Rhinology. 2011; 49: 570-576
        • Teufelberger A.R.
        • Broker B.M.
        • Krysko D.V.
        • Bachert C.
        • Krysko O.
        Staphylococcus aureus orchestrates type 2 airway diseases.
        Trends Mol Med. 2019; 25: 696-707
        • Patou J.
        • Gevaert P.
        • Van Zele T.
        • Holtappels G.
        • van Cauwenberge P.
        • Bachert C.
        Staphylococcus aureus enterotoxin B, protein A, and lipoteichoic acid stimulations in nasal polyps.
        J Allergy Clin Immunol. 2008; 121: 110-115
        • Wang X.
        • Zhang N.
        • Bo M.
        • Holtappels G.
        • Zheng M.
        • Lou H.
        • et al.
        Diversity of TH cytokine profiles in patients with chronic rhinosinusitis: a multicenter study in Europe, Asia, and Oceania.
        J Allergy Clin Immunol. 2016; 138: 1344-1353
        • Conley D.B.
        • Tripathi A.
        • Seiberling K.A.
        • Schleimer R.P.
        • Suh L.A.
        • Harris K.
        • et al.
        Superantigens and chronic rhinosinusitis: skewing of T-cell receptor V beta-distributions in polyp-derived CD4+ and CD8+ T cells.
        Am J Rhinol. 2006; 20: 534-539
        • Bernstein J.M.
        • Allen C.
        • Rich G.
        • Dryja D.
        • Bina P.
        • Reiser R.
        • et al.
        Further observations on the role of Staphylococcus aureus exotoxins and IgE in the pathogenesis of nasal polyposis.
        Laryngoscope. 2011; 121: 647-655
        • Tripathi A.
        • Kern R.
        • Conley D.B.
        • Seiberling K.
        • Klemens J.C.
        • Harris K.E.
        • et al.
        Staphylococcal exotoxins and nasal polyposis: analysis of systemic and local responses.
        Am J Rhinol. 2005; 19: 327-333
        • Bachert C.
        • Zhang N.
        • Holtappels G.
        • De Lobel L.
        • van Cauwenberge P.
        • Liu S.
        • et al.
        Presence of IL-5 protein and IgE antibodies to staphylococcal enterotoxins in nasal polyps is associated with comorbid asthma.
        J Allergy Clin Immunol. 2010; 126 (968 e1-6): 962-968
        • Lund V.J.
        • Kennedy D.W.
        Quantification for staging sinusitis. The Staging and Therapy Group.
        Ann Otol Rhinol Laryngol Suppl. 1995; 167: 17-21
        • Seiberling K.A.
        • Conley D.B.
        • Tripathi A.
        • Grammer L.C.
        • Shuh L.
        • Haines 3rd, G.K.
        • et al.
        Superantigens and chronic rhinosinusitis: detection of staphylococcal exotoxins in nasal polyps.
        Laryngoscope. 2005; 115: 1580-1585
        • Callahan J.E.
        • Kappler J.W.
        • Marrack P.
        Unexpected expansions of CD8-bearing cells in old mice.
        J Immunol. 1993; 151: 6657-6669
        • Huang L.
        • Betjes M.G.H.
        • Klepper M.
        • Langerak A.W.
        • Baan C.C.
        • Litjens N.H.R.
        End-stage renal disease causes skewing in the TCR Vbeta-repertoire primarily within CD8(+) T cell subsets.
        Front Immunol. 2017; 8: 1826
        • Thomas D.
        • Dauwalder O.
        • Brun V.
        • Badiou C.
        • Ferry T.
        • Etienne J.
        • et al.
        Staphylococcus aureus superantigens elicit redundant and extensive human Vbeta patterns.
        Infect Immun. 2009; 77: 2043-2050
        • Yoshino T.
        • Kondo E.
        • Cao L.
        • Takahashi K.
        • Hayashi K.
        • Nomura S.
        • et al.
        Inverse expression of bcl-2 protein and Fas antigen in lymphoblasts in peripheral lymph nodes and activated peripheral blood T and B lymphocytes.
        Blood. 1994; 83: 1856-1861
        • Strasser A.
        • Harris A.W.
        • Huang D.C.
        • Krammer P.H.
        • Cory S.
        Bcl-2 and Fas/APO-1 regulate distinct pathways to lymphocyte apoptosis.
        EMBO J. 1995; 14: 6136-6147
        • Akbar A.N.
        • Borthwick N.
        • Salmon M.
        • Gombert W.
        • Bofill M.
        • Shamsadeen N.
        • et al.
        The significance of low bcl-2 expression by CD45RO T cells in normal individuals and patients with acute viral infections. The role of apoptosis in T cell memory.
        J Exp Med. 1993; 178: 427-438
        • Cao P.P.
        • Li H.B.
        • Wang B.F.
        • Wang S.B.
        • You X.J.
        • Cui Y.H.
        • et al.
        Distinct immunopathologic characteristics of various types of chronic rhinosinusitis in adult Chinese.
        J Allergy Clin Immunol. 2009; 124 (484 e1-2): 478-484
        • Tomassen P.
        • Vandeplas G.
        • Van Zele T.
        • Cardell L.O.
        • Arebro J.
        • Olze H.
        • et al.
        Inflammatory endotypes of chronic rhinosinusitis based on cluster analysis of biomarkers.
        J Allergy Clin Immunol. 2016; 137: 1449-1456.e4
        • Lam E.P.
        • Kariyawasam H.H.
        • Rana B.M.
        • Durham S.R.
        • McKenzie A.N.
        • Powell N.
        • et al.
        IL-25/IL-33-responsive TH2 cells characterize nasal polyps with a default TH17 signature in nasal mucosa.
        J Allergy Clin Immunol. 2016; 137: 1514-1524
        • Kitajima M.
        • Lee H.C.
        • Nakayama T.
        • Ziegler S.F.
        TSLP enhances the function of helper type 2 cells.
        Eur J Immunol. 2011; 41: 1862-1871
        • Mitson-Salazar A.
        • Yin Y.
        • Wansley D.L.
        • Young M.
        • Bolan H.
        • Arceo S.
        • et al.
        Hematopoietic prostaglandin D synthase defines a proeosinophilic pathogenic effector human T(H)2 cell subpopulation with enhanced function.
        J Allergy Clin Immunol. 2016; 137: 907-918.e9
        • Cosmi L.
        • Annunziato F.
        • Iwasaki M.
        • Galli G.
        • Manetti R.
        • Maggi E.
        • et al.
        CRTH2 is the most reliable marker for the detection of circulating human type 2 Th and type 2 T cytotoxic cells in health and disease.
        Eur J Immunol. 2000; 30: 2972-2979
        • Cousins D.J.
        Pinning allergies on pathogenic TH2 cells.
        Sci Transl Med. 2017; 9: eaao0392
        • Bachert C.
        • Mannent L.
        • Naclerio R.M.
        • Mullol J.
        • Ferguson B.J.
        • Gevaert P.
        • et al.
        Effect of subcutaneous dupilumab on nasal polyp burden in patients with chronic sinusitis and nasal polyposis: a randomized clinical trial.
        JAMA. 2016; 315: 469-479
        • Bachert C.
        • Han J.K.
        • Desrosiers M.
        • Hellings P.W.
        • Amin N.
        • Lee S.E.
        • et al.
        Efficacy and safety of dupilumab in patients with severe chronic rhinosinusitis with nasal polyps (LIBERTY NP SINUS-24 and LIBERTY NP SINUS-52): results from two multicentre, randomised, double-blind, placebo-controlled, parallel-group phase 3 trials.
        Lancet. 2019; 394: 1638-1650
        • Okano M.
        • Fujiwara T.
        • Haruna T.
        • Kariya S.
        • Makihara S.
        • Higaki T.
        • et al.
        Role of fungal antigens in eosinophilia-associated cellular responses in nasal polyps: a comparison with enterotoxin.
        Clin Exp Allergy. 2011; 41: 171-178
        • el-Fiky L.M.
        • Khamis N.
        • Mostafa Bel D.
        • Adly A.M.
        Staphylococcal infection and toxin production in chronic rhinosinusitis.
        Am J Rhinol Allergy. 2009; 23: 264-267
        • Van Zele T.
        • Vaneechoutte M.
        • Holtappels G.
        • Gevaert P.
        • van Cauwenberge P.
        • Bachert C.
        Detection of enterotoxin DNA in Staphylococcus aureus strains obtained from the middle meatus in controls and nasal polyp patients.
        Am J Rhinol. 2008; 22: 223-227
        • Shin H.W.
        • Kim D.K.
        • Park M.H.
        • Eun K.M.
        • Lee M.
        • So D.
        • et al.
        IL-25 as a novel therapeutic target in nasal polyps of patients with chronic rhinosinusitis.
        J Allergy Clin Immunol. 2015; 135: 1476-1485.e7
        • Nagarkar D.R.
        • Poposki J.A.
        • Tan B.K.
        • Comeau M.R.
        • Peters A.T.
        • Hulse K.E.
        • et al.
        Thymic stromal lymphopoietin activity is increased in nasal polyps of patients with chronic rhinosinusitis.
        J Allergy Clin Immunol. 2013; 132: 593-600.e12
        • Wang Y.H.
        • Angkasekwinai P.
        • Lu N.
        • Voo K.S.
        • Arima K.
        • Hanabuchi S.
        • et al.
        IL-25 augments type 2 immune responses by enhancing the expansion and functions of TSLP-DC-activated Th2 memory cells.
        J Exp Med. 2007; 204: 1837-1847
        • Rochman Y.
        • Dienger-Stambaugh K.
        • Richgels P.K.
        • Lewkowich I.P.
        • Kartashov A.V.
        • Barski A.
        • et al.
        TSLP signaling in CD4(+) T cells programs a pathogenic T helper 2 cell state.
        Sci Signal. 2018; 11: eaam8858
        • Huvenne W.
        • Callebaut I.
        • Plantinga M.
        • Vanoirbeek J.A.
        • Krysko O.
        • Bullens D.M.
        • et al.
        Staphylococcus aureus enterotoxin B facilitates allergic sensitization in experimental asthma.
        Clin Exp Allergy. 2010; 40: 1079-1090
        • Lin Y.T.
        • Wang C.T.
        • Hsu C.T.
        • Wang L.F.
        • Shau W.Y.
        • Yang Y.H.
        • et al.
        Differential susceptibility to staphylococcal superantigen (SsAg)-induced apoptosis of CD4+ T cells from atopic dermatitis patients and healthy subjects: the inhibitory effect of IL-4 on SsAg-induced apoptosis.
        J Immunol. 2003; 171: 1102-1108
        • Lin Y.T.
        • Wang C.T.
        • Lee J.H.
        • Chu C.Y.
        • Tsao W.C.
        • Yang Y.H.
        • et al.
        Higher Bcl-2 levels decrease staphylococcal superantigen-induced apoptosis of CD4+ T cells in atopic dermatitis.
        Allergy. 2007; 62: 520-526
        • Bachert C.
        • van Steen K.
        • Zhang N.
        • Holtappels G.
        • Cattaert T.
        • Maus B.
        • et al.
        Specific IgE against Staphylococcus aureus enterotoxins: an independent risk factor for asthma.
        J Allergy Clin Immunol. 2012; 130: 376-381.e8

      Linked Article

      • Corrigenda
        Journal of Allergy and Clinical ImmunologyVol. 146Issue 2
        • Preview
          In regards to the article in the May 2020 issue entitled “Superantigen-related TH2 CD4+ T cells in nonasthmatic chronic rhinosinusitis with nasal polyps” (J Allergy Clin Immunol 2020;145:1378-88.e10), the Editors were notified that the affiliation for co-first author Dr Sang-Wook Kim was incompletely listed. The affiliation is correctly listed as Gyeongsang National University and Gyeongsang National University Hospital. The authors regret the error.
        • Full-Text
        • PDF