Advertisement

Loss-of-function mutations in caspase recruitment domain-containing protein 14 (CARD14) are associated with a severe variant of atopic dermatitis

Published:September 21, 2018DOI:https://doi.org/10.1016/j.jaci.2018.09.002

      Background

      Atopic dermatitis (AD) is a highly prevalent chronic inflammatory skin disease that is known to be, at least in part, genetically determined. Mutations in caspase recruitment domain-containing protein 14 (CARD14) have been shown to result in various forms of psoriasis and related disorders.

      Objective

      We aimed to identify rare DNA variants conferring a significant risk for AD through genetic and functional studies in a cohort of patients affected with severe AD.

      Methods

      Whole-exome and direct gene sequencing, immunohistochemistry, real-time PCR, ELISA, and functional assays in human keratinocytes were used.

      Results

      In a cohort of patients referred with severe AD, DNA sequencing revealed in 4 patients 2 rare heterozygous missense mutations in the gene encoding CARD14, a major regulator of nuclear factor κB (NF-κB). A dual luciferase reporter assay demonstrated that both mutations exert a dominant loss-of-function effect and result in decreased NF-κB signaling. Accordingly, immunohistochemistry staining showed decreased expression of CARD14 in patients' skin, as well as decreased levels of activated p65, a surrogate marker for NF-κB activity. CARD14-deficient or mutant-expressing keratinocytes displayed abnormal secretion of key mediators of innate immunity.

      Conclusions

      Although dominant gain-of-function mutations in CARD14 are associated with psoriasis and related diseases, loss-of-function mutations in the same gene are associated with a severe variant of AD.

      Graphical abstract

      Key words

      Abbreviations used:

      AD (Atopic dermatitis), AMP (Antimicrobial peptide), CARD14 (Caspase recruitment domain-containing protein 14), hBD (Human β-defensin), KGM (Keratinocyte Growth Medium), NF-κB (Nuclear factor κB), siRNA (Small interfering RNA), TSLP (Thymic stromal lymphopoietin)
      Atopic dermatitis (AD) is an extremely prevalent disorder very often manifesting initially in infancy and childhood and persisting in a minority of affected subjects into adulthood.
      • Weidinger S.
      • Novak N.
      Atopic dermatitis.
      AD is recognized as a prototypical multifactorial condition resulting from a combination of genetically determined defects and environmental exposures and eventually leading to skin barrier disruption and both cutaneous and systemic immunologic dysfunction.
      • Otsuka A.
      • Nomura T.
      • Rerknimitr P.
      • Seidel J.A.
      • Honda T.
      • Kabashima K.
      The interplay between genetic and environmental factors in the pathogenesis of atopic dermatitis.
      • Kim B.E.
      • Leung D.Y.M.
      Significance of skin barrier dysfunction in atopic dermatitis.
      Extensive attempts at delineating the genetic causes of the disease through genome-wide association studies have revealed a large number of susceptibility loci near genes affecting both barrier function and immune regulation, most of which contain variations conferring a slight to moderate risk for the disease only.
      • Paternoster L.
      • Standl M.
      • Waage J.
      • Baurecht H.
      • Hotze M.
      • Strachan D.P.
      • et al.
      Multi-ancestry genome-wide association study of 21,000 cases and 95,000 controls identifies new risk loci for atopic dermatitis.
      • Ferreira M.A.R.
      • Vonk J.M.
      • Baurecht H.
      • Marenholz I.
      • Tian C.
      • Hoffman J.D.
      • et al.
      Eleven loci with new reproducible genetic associations with allergic disease risk.
      A notable exception is the gene encoding filaggrin (FLG), in which germline mutations have been shown to confer a remarkably high risk for AD.
      • Irvine A.D.
      • McLean W.H.
      • Leung D.Y.
      Filaggrin mutations associated with skin and allergic diseases.
      Nonetheless, although null mutations in FLG are considered the strongest genetic risk factors for AD, they are found in less than half of patients.
      • Irvine A.D.
      • McLean W.H.
      • Leung D.Y.
      Filaggrin mutations associated with skin and allergic diseases.
      In fact, currently available genetic data seem to barely explain 25% of AD heritability.
      • Ellinghaus D.
      • Baurecht H.
      • Esparza-Gordillo J.
      • Rodriguez E.
      • Matanovic A.
      • Marenholz I.
      • et al.
      High-density genotyping study identifies four new susceptibility loci for atopic dermatitis.
      As an alternative to genome-wide association–based approaches, the study of rare instances of quasimonogenic inheritance of conditions usually inherited as complex traits can often reveal genetic variations exerting a strong effect on the propensity to develop complex traits,
      • Peltonen L.
      • Perola M.
      • Naukkarinen J.
      • Palotie A.
      Lessons from studying monogenic disease for common disease.
      such as allergy and AD.
      • Lyons J.J.
      • Milner J.D.
      Primary atopic disorders.
      The description of dominant negative mutations in CARD11, a structurally and functionally homologous gene, to caspase recruitment domain-containing protein 14 (CARD14) leading to severe AD,
      • Ma C.A.
      • Stinson J.R.
      • Zhang Y.
      • Abbott J.K.
      • Weinreich M.A.
      • Hauk P.J.
      • et al.
      Germline hypomorphic CARD11 mutations in severe atopic disease.
      after the description of CARD11 variants identified as risk factors for common AD in genome-wide association studies,
      • Hirota T.
      • Takahashi A.
      • Kubo M.
      • Tsunoda T.
      • Tomita K.
      • Sakashita M.
      • et al.
      Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population.
      remarkably illustrates the strengths of this approach. Similarly, the role of CARD14 in the pathogenesis of several inflammatory conditions was initially revealed through the study of rare familial cases of psoriasis and pityriasis rubra pilaris,
      • Jordan C.T.
      • Cao L.
      • Roberson E.D.
      • Pierson K.C.
      • Yang C.F.
      • Joyce C.E.
      • et al.
      PSORS2 is due to mutations in CARD14.
      • Fuchs-Telem D.
      • Sarig O.
      • van Steensel M.A.
      • Isakov O.
      • Israeli S.
      • Nousbeck J.
      • et al.
      Familial pityriasis rubra pilaris is caused by mutations in CARD14.
      which later led to recognition of CARD14 as a strong susceptibility gene in sporadic forms of these diseases.
      • Jordan C.T.
      • Cao L.
      • Roberson E.D.
      • Duan S.
      • Helms C.A.
      • Nair R.P.
      • et al.
      Rare and common variants in CARD14, encoding an epidermal regulator of NF-kappaB, in psoriasis.
      • Li Q.
      • Jin Chung H.
      • Ross N.
      • Keller M.
      • Andrews J.
      • Kingman J.
      • et al.
      Analysis of CARD14 polymorphisms in pityriasis rubra pilaris: activation of NF-κB.
      • Berki D.M.
      • Liu L.
      • Choon S.E.
      • David Burden A.
      • Griffiths C.E.M.
      • Navarini A.A.
      • et al.
      Activating CARD14 mutations are associated with generalized pustular psoriasis but rarely account for familial recurrence in psoriasis vulgaris.
      Psoriasis-causing mutations in CARD14 were found to exert a gain-of-function effect and to result in heightened nuclear factor κB (NF-κB) signaling,
      • Jordan C.T.
      • Cao L.
      • Roberson E.D.
      • Pierson K.C.
      • Yang C.F.
      • Joyce C.E.
      • et al.
      PSORS2 is due to mutations in CARD14.
      • Fuchs-Telem D.
      • Sarig O.
      • van Steensel M.A.
      • Isakov O.
      • Israeli S.
      • Nousbeck J.
      • et al.
      Familial pityriasis rubra pilaris is caused by mutations in CARD14.
      • Howes A.
      • O'Sullivan P.A.
      • Breyer F.
      • Ghose A.
      • Cao L.
      • Krappmann D.
      • et al.
      Psoriasis mutations disrupt CARD14 autoinhibition promoting BCL10-MALT1-dependent NF-kappaB activation.
      leading to production of pathogenic inflammatory mediators. Here we demonstrate that dominant loss-of-function mutations in CARD14 result in an unusually severe form of AD, decreased NF-κB signaling, and concomitant dysregulation of critical innate immunity-associated mediators previously implicated in AD pathogenesis.

      Methods

       Patients

      All affected and healthy family members or their legal guardians provided written informed consent according to protocols approved by the institutional review board of the National Institute of Health (NCT00557895 and NCT00852943) and of the Johns Hopkins All Children Hospital (IRB00097062). Genomic DNA was extracted from peripheral blood leukocytes of each participant by using the Gentra Puregene Blood Kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions.

       Whole-exome sequencing

      DNA samples obtained from subjects belonging to families 1 and 3 were subjected to whole-exome sequencing by using the Ion Torrent AmpliSeq RDY Exome Kit (Life Technologies, Grand Island, NY) and the Ion Chef and Proton instruments (Life Technologies). Briefly, 100 ng of genomic DNA was used as the starting material for the AmpliSeq RDY Exome amplification step, according to the manufacturer's protocol. Library templates were clonally amplified and enriched with the Ion Chef and Ion PI Hi-Q Chef Kit (Chef package, version IC.4.4.2; Life Technologies), according to the manufacturer's protocol. Enriched, templated Ion Sphere Particles were sequenced on the Ion Proton sequencer by using the Ion PI chip v3 (Life Technologies).
      Reads were aligned to the Genome Reference Consortium Human Build 37 (GRCh37/hg19) by using Burrows-Wheeler transformation.
      • Li H.
      • Durbin R.
      Fast and accurate long-read alignment with Burrows-Wheeler transform.
      Duplicate reads resulting from PCR clonality or optical duplicates and reads mapping to multiple locations were excluded from downstream analysis. Reads mapping to a region of known or detected insertions or deletions were realigned to minimize alignment errors. Single nucleotide substitutions and small insertions-deletions were identified and quality filtered by using the Genome Analysis Tool Kit.
      • McKenna A.
      • Hanna M.
      • Banks E.
      • Sivachenko A.
      • Cibulskis K.
      • Kernytsky A.
      • et al.
      The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data.
      Rare variants were identified by using ANNOVAR
      • Wang K.
      • Li M.
      • Hakonarson H.
      ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data.
      and filtered with data from dbSNP142, the 1000 Genomes Project, HGMD, gnomAD, Ensemble, Exome Variant Server, and an in-house database of individual exomes. Variants were classified by predicted protein effects by using Polyphen2
      • Adzhubei I.A.
      • Schmidt S.
      • Peshkin L.
      • Ramensky V.E.
      • Gerasimova A.
      • Bork P.
      • et al.
      A method and server for predicting damaging missense mutations.
      and SIFT.
      • Kumar P.
      • Henikoff S.
      • Ng P.C.
      Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm.
      Validation and cosegregation of the disease phenotype with the mutation were verified by using Sanger sequencing. For patient II-1, family 2, a targeted 207-gene, immune-related disease, clinical sequencing panel was performed by Invitae (San Francisco, Calif) using Illumina next-generation sequencing technology (Illumina, San Diego, Calif).

       Direct sequencing

      Genomic DNA was PCR amplified with oligonucleotide primer pairs spanning relevant exon sequences (see Table E1 in this article's Online Repository at www.jacionline.org) with Taq polymerase (Qiagen, Hilden, Germany). Cycling conditions were as follows: 94°C for 2 minutes, 94°C for 40 seconds, 61°C for 40 seconds, 72°C for 50 seconds for 3 cycles, and 94°C for 40 seconds; 59°C for 40 seconds; 72°C for 50 seconds for 3 cycles and 94°C for 40 seconds; 57°C for 40 seconds; and 72°C for 50 seconds for 34 cycles. Gel-purified (QIAquick gel extraction kit; Qiagen) amplicons were subjected to bidirectional DNA sequencing with the BigDye terminator system on an ABI Prism 3100 sequencer (Applied Biosystems, Foster City, Calif) by using oligonucleotides used for PCR.

       Quantitative real-time PCR

      For quantitative RT-PCR, cDNA was synthesized from 1000 ng of total RNA with the qScript kit (Quanta Biosciences, Gaithersburg, Md). cDNA PCR amplification was carried out with the PerfeCTa SYBR Green FastMix (Quanta Biosciences) on a StepOnePlus system (Applied Biosystems, Waltham, Mass) with gene-specific intron-crossing oligonucleotides (see Table E2 in this article's Online Repository at www.jacionline.org). Cycling conditions were as follows: 95°C for 20 seconds and then 95°C for 3 seconds and 60°C for 30 seconds for 40 cycles. Each sample was analyzed in triplicate. For each set of primers, standard curves were obtained with serially diluted cDNAs. Results were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels.

       Immunohistochemical staining

      After antigen retrieval with 0.01 mol/L citrate buffer (pH 6.0; Invitrogen, Carlsbad, Calif) in a microwave for 25 minutes, blocking with hydrogen peroxide for 10 minutes, and protein blocking for 40 minutes, 5-μm-thick paraffin-embedded sections fixed on Plus glass slides (Menzel Gläser, Braunschweig, Germany) were processed by using an automated immunostainer (Benchmark-XT; Ventana Medical System, Tucson, Ariz) with primary antibodies directed against human β-defensin (hBD) 1 (ab14425), hBD-2 (ab63982), hCCL20 (ab9829; Abcam, Cambridge, Mass), CARD14 (Novus Biologicals, Littleton, Colo), and the activated p65 subunit (Millipore, Billerica, Mass), as previously described.
      • Fuchs-Telem D.
      • Sarig O.
      • van Steensel M.A.
      • Isakov O.
      • Israeli S.
      • Nousbeck J.
      • et al.
      Familial pityriasis rubra pilaris is caused by mutations in CARD14.
      Negative controls consisted of slides processed while omitting the primary antibody. Visualization of the bound primary antibodies was performed with the HRP/AEC (ABC) Detection IHC Kit (Abcam). Sections were then counterstained with Gill hematoxylin, dehydrated, and mounted for microscopic examination. Specimens were examined with a Nikon 50I microscope connected to a DS-RI1 digital camera (Nikon, Tokyo, Japan).
      Immunohistochemistry staining intensity was quantified with ImageJ software (National Institutes of Health, Bethesda, Md).

       Cell cultures

      Primary keratinocytes were isolated from adult skin obtained from plastic surgery specimens after having received written informed consent from the donors according to a protocol reviewed and approved by the Tel Aviv Sourasky Medical center institutional review board, as previously described.
      • Samuelov L.
      • Sarig O.
      • Harmon R.M.
      • Rapaport D.
      • Ishida-Yamamoto A.
      • Isakov O.
      • et al.
      Desmoglein 1 deficiency results in severe dermatitis, multiple allergies and metabolic wasting.
      Primary keratinocytes were maintained in Keratinocyte Growth Medium (KGM; Lonza, Walkersville, Md).
      HEK293 cells were cultured in high-glucose Dulbecco modified Eagle medium with 10% FCS, 1% L-glutamine, and 1% penicillin/streptomycin (Biological Industries, Beit-Haemek, Israel).

       Small interfering RNA transfection

      Primary human keratinocytes were grown in triplicate in 6-well plates at 37°C in 5% CO2 in a humidified incubator. After 5 days, keratinocytes at 60% to 70% confluency were transfected with a CARD14-specific small interfering RNA (siRNA; sc-60330) or control siRNA-Stealth RNAi Negative Control Duplex (Invitrogen, Carlsbad, Calif). The efficacy of siRNA-mediated CARD14 downregulation was ascertained by using real-time PCR and Western blotting (see Fig E1 in this article's Online Repository at www.jacionline.org).

       NF-κB reporter assay

      To examine the effect of the CARD14 variants on NF-κB activation, we cotransfected HEK293 cells (15,000 cells per well were seeded in a white flat-bottom 96-well microplate) with a luciferase reporter under a NF-κB–responsive element, a Renilla expression vector, and several CARD14 cDNA constructs carrying either a wild-type sequence or the CARD14 mutations (pCMV6-Entry Vector; Origene, Rockville, Md) by using Lipofectamine 2000, according to the manufacturer's protocol (Invitrogen). Mutations were introduced into the CARD14 sequence by using a mutagenesis service (Genscript, Piscataway, NJ) and validated by means of Sanger sequencing. As a positive control, we used a construct encoding the gain-of-function p.E138del variant,
      • Fuchs-Telem D.
      • Sarig O.
      • van Steensel M.A.
      • Isakov O.
      • Israeli S.
      • Nousbeck J.
      • et al.
      Familial pityriasis rubra pilaris is caused by mutations in CARD14.
      as described previously.
      • Li Q.
      • Jin Chung H.
      • Ross N.
      • Keller M.
      • Andrews J.
      • Kingman J.
      • et al.
      Analysis of CARD14 polymorphisms in pityriasis rubra pilaris: activation of NF-κB.
      Twenty-four hours after transfection, luciferase activity was read with a dual luciferase assay (Promega, Madison, Wis). Luciferase activity was normalized to Renilla luciferase activity.

       ELISA

      Primary keratinocytes were cultured in KGM (Lonza, Walkersville, Md) containing 0.075 mmol/L CaCl2 supplemented with 0.4% bovine pituitary extract, 0.1% human epidermal growth factor, 0.1% insulin, 0.1% hydrocortisone, and 0.1% gentamicin/amphotericin B.
      Keratinocytes were seeded into 6- or 12-well plates at 37°C in 5% CO2 in a humidified incubator, adhered overnight, washed, and incubated with KGM up to 70% confluency. Before performing the experiment, cells were washed, and fresh medium was added without KGM supplements. Cells were then transfected with either human CARD14 siRNA (sc-60330; Santa Cruz Biotechnology, Dallas, Tex) or control siRNA (Stealth RNAi Negative Control Duplex; Invitrogen) with Lipofectamine RNAiMax (Invitrogen) or with various CARD14 constructs, as indicated in the figure legends. Transfection medium was replaced 6 hours after transfection with the same minimal medium, and cells were then maintained in growth medium (KGM) without supplements for 48 hours. For hCCL20 level measurements, cells were maintained after transfection in KGM without hydrocortisone supplemented with 0.05% inactivated FBS for 24 hours. Cell lysates and media were collected, placed in aliquots, and kept at −80°C until analyzed by using quantitative RT-PCR or ELISA, respectively.
      Protein levels of hBD-1, hBD-2, hLL-37, hCCL20, and thymic stromal lymphopoietin (TSLP) secreted into the cell medium or hIL-33 present in cell lysates (proteins were extracted from cell lysates by using Lysis Buffer 17; catalog no. 895943; R&D Systems, Minneapolis, Minn), according to the manufacturer's instructions, were measured by using the following ELISA kits, according to the manufacturers' instructions: hBD-1 (catalog no. 900-K202; PeproTech, Rocky Hills, NJ), hBD-2 (catalog no. 900-K172; PeproTech), hLL-37 (catalog no. HK321; Hycult Biotech, Wayne, Pa), hCCL20 (catalog no. DM3A00; R&D Systems), hIL-33 (catalog no. D3300B; R&D Systems), and TSLP (catalog no. DTSLP0; R&D Systems). Each experiment was repeated at least 3 times, and ELISA measurements were done in duplicates.

       Western blotting

      Cells were homogenized in CelLytic MT lysis/extraction reagent (Sigma-Aldrich, St Louis, Mo) supplemented with protease inhibitor mix, including 1 mmol/L phenylmethanesulfonyl fluoride and 1 mg/mL aprotinin and leupeptin (Sigma-Aldrich). After centrifugation at 10,000g for 10 minutes at 4°C, proteins were electrophoresed through a 7.5% SDS-PAGE and transferred onto a nitrocellulose membrane (BioTrace NT Nitrocellulose; Pall, Washington, NY). After blocking for 1 hour by using 1× TBS-Tween (50 mmol/L Tris, 150 mmol/L NaCl, and 0.01% Tween 20) with 3% BSA, blots were incubated overnight at 4°C with a primary rabbit polyclonal anti-CARD14 antibody (diluted 1:500; Proteintech, Rosemont, Ill). The blots were washed 5 times for 5 minutes with 1× TBS-Tween and 1.5% BSA. After incubation with a secondary horseradish peroxidase–conjugated anti-rabbit antibody (diluted 1:5000; Sigma-Aldrich) and subsequent washings (5 times for 5 minutes each with 1× TBS-Tween), proteins were detected with the EZ-ECL chemiluminescence detection kit (Biological Industries, Cromwell, Conn). Blots were reprobed with a mouse mAb against β-actin (Sigma-Aldrich) to compare the amount of protein loaded in different samples.

      Results

       Clinical findings

      We studied 3 patients (the index patients from families 1, 2, and 3; Fig 1, A) from a cohort of patients referred to tertiary care centers for severe AD. Clinical information on all families is summarized in Table E3 in this article's Online Repository at www.jacionline.org.
      Figure thumbnail gr1
      Fig 1Clinical and histopathologic features. A, Pedigrees of the 3 families. Black symbols indicate severe AD; wild-type and mutant alleles are denoted as and +, respectively. B and C, Subject II-1, family 1, presented with erythroderma with fine scales involving more than 90% of his body surface area (Fig 1, B) and prominent fissuring and accentuation of the skin folds (Fig 1, C). D, Histopathologic examination of a skin biopsy specimen obtained from this subject's leg reveals parakeratosis, hypogranulosis, prominent spongiosis, acanthosis, and psoriasiform epidermal hyperplasia associated with occasional lymphocyte exocytosis and a perivascular mild lymphocytic infiltrate.
      Patient 1 (family 1, subject II-1; Fig 1, A) is a 14-year-old boy of Hispanic ancestry who had very dry skin during the first year of life and was given a diagnosis of AD. His condition was controlled with topical agents until age 9 years, when he had recurrent skin infections and bacterial abscesses requiring multiple hospitalizations. In addition, he had poorly controlled moderate persistent asthma, food allergy, and allergic rhinitis. He had no significant systemic noncutaneous infections. Short stature and precocious puberty were thought to be secondary to chronic steroid use. Aside from increased IgE levels (>74,000 IU/mL), as well as marginally increased IgG levels (2000 mg/dL) with slightly low IgM levels (28 mg/dL), laboratory values were unremarkable, with normal lymphocyte subsets and specific antibody titers. His family history was remarkable for childhood AD with superinfection, asthma, and seasonal allergy in his mother and mild AD in his father. He had negative results for signal transducer and activator of transcription 3 (STAT3) and dedicator of cytokinesis 8 (DOCK8) mutations (not shown). Oral cyclosporine treatment and multiple regimens of oral corticosteroids failed, but the patient improved with inpatient wet-wrap therapy.
      Patient 2 (family 2, subject II-1; Fig 1, A) is a sporadic case in her family. Patient 2 is a 17-year-old white girl with a lifelong history of AD beginning at 6 months of age and worsening during the adolescent years, which led to multiple hospitalizations. AD flares were complicated by skin infections. She had food allergies and moderate persistent asthma, which led to multiple hospitalizations during respiratory tract infection episodes, allergic rhinitis requiring immunotherapy, alopecia secondary to severe scalp involvement, and vitiligo. Immunologic evaluation demonstrated intermittently low B-cell counts and greatly increased IgE levels (>50,000 IU/mL), which persisted despite improvement of her skin condition. Specific antibody responses to polysaccharide vaccine were normal, but titer persistence was short-lived. Results of T-cell studies were normal. She had no family history of atopy. Mycophenolate mofetil led to partial improvement, and intravenous immunoglobulins resulted in almost clear skin.
      Patient 3 (family 3, subject II-1; Fig 1, A) is a 13-year-old African American girl born at term. Severe AD was diagnosed at 3 months of age. The patient had poorly controlled moderate persistent asthma with multiple exacerbations requiring hospitalization, especially when secondary to upper respiratory tract infections. At least 4 asthma exacerbations were accompanied by symptoms and chest x-ray results were consistent with pneumonia; however, no infectious organism was isolated, and subsequent chest computed tomographic results were normal. She was noted to have food allergy, gastric esophageal reflux disease, nontraumatic fractures, retained primary teeth, viral skin infections, and recurrent skin abscesses, as well as extremity osteomyelitis likely secondary to chronic subungual infections. Her laboratory workup was largely unremarkable aside from markedly increased IgE levels (5-13,000 IU/mL) and pneumococcal antibody titers that varied from low to normal without immunization. Her family history was significant for AD in her father associated with asthma, food allergy skin boils, and respiratory tract infections. She has 3 maternal half-brothers with asthma, allergic rhinitis, and mild AD. Her disease was resistant to multiple treatments, including wet wraps, bleach baths, UVB therapy, and multiple courses of systemic steroids, which resulted in adrenal suppression.

       Mutation analysis

      DNA samples obtained from the patients were subjected to deep sequencing. Putative pathogenic changes were validated in the patients and relatives from whom material was available by using Sanger sequencing (see Table E4 in this article's Online Repository at www.jacionline.org for list of rare variations found in the whole-exome sequencing analysis). Subject II-1 from family 1 and subject II-1 from family 2 were found to carry the same heterozygous missense mutation in CARD14 (c.1778T>C, p.I593T), whereas subject II-1 from family 3 was found to carry a different heterozygous missense mutation (c.2209A>C, p.N737H; Fig 2, A). The 2 mutations result in single amino acid substitutions (Fig 2, B), are extremely rare, affect highly conserved residues, and are foreseen to be pathogenic by using various prediction algorithms (see Table E5 in this article's Online Repository at www.jacionline.org). The mutations were found to segregate with the atopic phenotype in families 1 and 3 (Fig 1, A), although the phenotype of the mother of the proband in family 1 was less severe (Fig 1, A, and see Table E3).
      Figure thumbnail gr2
      Fig 2Mutation analysis. A, Direct sequencing of CARD14 revealed a heterozygous T>C transition (arrow) at position c.1778 of the cDNA sequence in subject II-1, family 1 (upper left panel), as well as a heterozygous A>C transversion (arrow) at position c.2209 of the cDNA sequence in subject II-1, family 3 (upper right panel). The wild-type sequences (WT/WT) are given for comparison (lower panels). B, Location of the 2 mutations is depicted along a schematic representation of the CARD14 protein and its domains.

       AD-associated mutations in CARD14 exert a dominant negative effect and impair NF-κB activation

      The 2 mutations are located in the structural PDZ-SH3-GUK module, also known as the membrane-associated GUK domain (Fig 2, B). This domain is essential for proper CARD14 function,
      • Jiang C.
      • Lin X.
      Regulation of NF-κB by the CARD proteins.
      which suggests that the mutations can affect CARD14 capacity to regulate NF-κB signaling.
      • Jiang C.
      • Lin X.
      Regulation of NF-κB by the CARD proteins.
      Therefore we used an NF-κB luciferase reporter system, as previously described.
      • Li Q.
      • Jin Chung H.
      • Ross N.
      • Keller M.
      • Andrews J.
      • Kingman J.
      • et al.
      Analysis of CARD14 polymorphisms in pityriasis rubra pilaris: activation of NF-κB.
      Briefly, we cotransfected HEK293 cells with an NF-κB luciferase reporter plasmid and with a CARD14 wild-type expression vector or the same vector carrying either of the 2 CARD14 AD-associated mutations. Both mutations significantly attenuated the ability of CARD14 to activate NF-κB (Fig 3, A). Cotransfection of equal quantities of mutant and wild-type CARD14 expression vectors led to impaired luciferase activity when compared with that measured after transfection of the same quantity of wild-type vector alone, showing that the loss-of-function variants exert a dominant negative effect (see Fig E2 in this article's Online Repository at www.jacionline.org).
      Figure thumbnail gr3
      Fig 3Consequences of AD-associated mutations in CARD14. A, HEK293 cells were cotransfected with an NF-κB–responsive luciferase reporter gene and plasmids expressing either wild-type CARD14 cDNA or CARD14 cDNA harboring p.I593T or p.N737H mutations. Luciferase activity was measured after 24 hours and normalized to Renilla luciferase. Results represent means ± SEs of 3 independent experiments. ***P < .001, 2-sided t test. B, Skin biopsy specimens obtained from the thigh of subject II-1, family 1, and from a healthy control subject were stained for CARD14 or activated p65 (counterstaining with hematoxylin). Scale bars = 100 μm. C, Immunohistochemistry staining intensity was quantified with ImageJ software. ***P < .001, 2-sided t test.
      Gain-of-function mutations in CARD14 result in increased expression of both CARD14 itself and activated p65 (a surrogate marker for NF-κB activity) in the skin of patients with psoriasis and pityriasis rubra pilaris.
      • Jordan C.T.
      • Cao L.
      • Roberson E.D.
      • Pierson K.C.
      • Yang C.F.
      • Joyce C.E.
      • et al.
      PSORS2 is due to mutations in CARD14.
      • Fuchs-Telem D.
      • Sarig O.
      • van Steensel M.A.
      • Isakov O.
      • Israeli S.
      • Nousbeck J.
      • et al.
      Familial pityriasis rubra pilaris is caused by mutations in CARD14.
      Therefore we hypothesized that loss-of-function mutations in the same gene should lead to the reverse phenotype in our patients with severe AD. Indeed, we found a significant decrease in the expression of both CARD14 and the activated p65 subunit of NF-κB compared with that seen in healthy control subjects (Fig 3, B and C).

       CARD14 loss of function impairs epidermal secretion of antimicrobial peptides and hCCL20

      The pathogenesis of atopic disease caused by CARD11 dominant negative mutations both in human subjects
      • Ma C.A.
      • Stinson J.R.
      • Zhang Y.
      • Abbott J.K.
      • Weinreich M.A.
      • Hauk P.J.
      • et al.
      Germline hypomorphic CARD11 mutations in severe atopic disease.
      and mice
      • Jun J.E.
      • Wilson L.E.
      • Vinuesa C.G.
      • Lesage S.
      • Blery M.
      • Miosge L.A.
      • et al.
      Identifying the MAGUK protein Carma-1 as a central regulator of humoral immune responses and atopy by genome-wide mouse mutagenesis.
      is likely due to marked defects in the hematopoietic tissues, where it is mostly expressed. Conversely, CARD14 expression is largely confined to epidermal cells.
      • Fuchs-Telem D.
      • Sarig O.
      • van Steensel M.A.
      • Isakov O.
      • Israeli S.
      • Nousbeck J.
      • et al.
      Familial pityriasis rubra pilaris is caused by mutations in CARD14.
      CARD14 is a major regulator of NF-κB, and NF-κB signaling is known to regulate innate immunity, which in turn has been implicated in the pathogenesis of inflammatory skin diseases.
      • Akiyama M.
      • Takeichi T.
      • McGrath J.A.
      • Sugiura K.
      Autoinflammatory keratinization diseases.
      Therefore we used RNA interference to downregulate CARD14 in keratinocytes or transfected wild-type or mutant CARD14 expression vectors in keratinocytes and then examined the expression of pivotal mediators of innate immunity in human primary keratinocytes. Keratinocytes with reduced CARD14 expression expressed significantly less hBD1, hBD2, and hCCL20 than keratinocytes transfected with control siRNA at both the protein level (Fig 4, A) and the RNA level (see Fig E3 in this article's Online Repository at www.jacionline.org). Moreover, keratinocytes expressing mutant CARD14 also released significantly less hBD1, hBD2, and hCCL20 (Fig 4, B). LL-37 levels remained unchanged in both sets of experiments (Fig 4). Accordingly, hBD1, hBD2, and hCCL20 expression was markedly reduced in the epidermis of a patient carrying a loss-of-function CARD14 mutation compared with healthy control subjects or patients with psoriasis (Fig 5). Of note, no significant changes were seen in expression levels of IL-33 and TSLP in keratinocytes transfected with mutant CARD14, suggesting that the pathogenesis of the allergic inflammation is not primarily driven by these epithelium-produced, AD-related proteins (see Fig E4 in this article's Online Repository at www.jacionline.org).
      Figure thumbnail gr4
      Fig 4Inflammatory gene expression in CARD14-deficient keratinocytes and CARD14 loss-of-function mutations. A, Keratinocytes were transfected with CARD14-specific siRNA or control siRNA. Protein levels of hBD-1, hBD-2, LL-37, and hCCL20 secreted into the culture medium were measured by using ELISAs, according to the manufacturer's instructions. Results are expressed as the percentage of protein expression levels relative to expression in control siRNA-transfected samples ± SE. B, Keratinocytes were transfected with wild-type (WT) or mutant CARD14 (p.I593T or p.N737H) cDNA constructs and then maintained in growth medium (KGM) without supplements for 48 hours or for 24 hours in the case of hCCL20. Protein levels of hBD-1, hBD-2, hLL-37, and hCCL20 secreted into the culture medium were measured by using ELISAs, according to the manufacturer's instructions. Results are expressed as the percentage of protein expression levels relative to expression in wild-type CARD14-transfected samples ± SE. Results represent the mean of at least 3 independent experiments. *P < .05, **P < .01, and ***P < .005, 2-sided t test.
      Figure thumbnail gr5
      Fig 5hCCL20, hBD-1, and hBD-2 expression in skin biopsy specimens. Skin biopsy specimens obtained from the thigh of subject II-1, family 1; a healthy control subject; and a patient with psoriasis were stained for hCCL20, hBD-1, and hBD-2. Scale bars = 100 μm. Immunohistochemistry staining intensity was quantified by using ImageJ software (right panels). ***P < .001, 2-sided t test.

      Discussion

      In the present study we demonstrate the presence of dominant negative, loss-of-function mutations in CARD14 in 3 patients with unusually severe AD. CARD14 has recently emerged as a major player in psoriasis, as well as the related disorder, pityriasis rubra pilaris.
      • Jordan C.T.
      • Cao L.
      • Roberson E.D.
      • Pierson K.C.
      • Yang C.F.
      • Joyce C.E.
      • et al.
      PSORS2 is due to mutations in CARD14.
      • Fuchs-Telem D.
      • Sarig O.
      • van Steensel M.A.
      • Isakov O.
      • Israeli S.
      • Nousbeck J.
      • et al.
      Familial pityriasis rubra pilaris is caused by mutations in CARD14.
      In contrast to the dichotomist approach to the relationship between psoriasis and AD, which was prevalent in the past,
      • Biedermann T.
      • Rocken M.
      • Carballido J.M.
      TH1 and TH2 lymphocyte development and regulation of TH cell-mediated immune responses of the skin.
      more recent studies have highlighted overlapping pathomechanisms in patients with those 2 conditions, which mostly involve elements traditionally associated with adaptive immune responses.
      • Sidler D.
      • Wu P.
      • Herro R.
      • Claus M.
      • Wolf D.
      • Kawakami Y.
      • et al.
      TWEAK mediates inflammation in experimental atopic dermatitis and psoriasis.
      • Guttman-Yassky E.
      • Krueger J.G.
      Atopic dermatitis and psoriasis: two different immune diseases or one spectrum?.
      For example, the TH17 pathway has been implicated in the pathogenesis of both diseases
      • Brunner P.M.
      • Guttman-Yassky E.
      • Leung D.Y.
      The immunology of atopic dermatitis and its reversibility with broad-spectrum and targeted therapies.
      : the TH17 axis plays a major role in the pathogenesis of psoriasis,
      • Girolomoni G.
      • Strohal R.
      • Puig L.
      • Bachelez H.
      • Barker J.
      • Boehncke W.H.
      • et al.
      The role of IL-23 and the IL-23/TH 17 immune axis in the pathogenesis and treatment of psoriasis.
      whereas its role has also been documented in a number of AD subsets, including AD in patients of Asian origin, pediatric AD, and intrinsic AD.
      • Nomura T.
      • Honda T.
      • Kabashima K.
      Multipolarity of cytokine axes in the pathogenesis of atopic dermatitis in terms of age, race, species, disease stage and biomarkers.
      • Brunner P.M.
      • Israel A.
      • Zhang N.
      • Leonard A.
      • Wen H.C.
      • Huynh T.
      • et al.
      Early-onset pediatric atopic dermatitis is characterized by TH2/TH17/TH22-centered inflammation and lipid alterations.
      The fact that only some forms of AD are (at least in part) TH17 driven might explain the lack of a uniform response of AD to TH17-targeting treatments.
      • Khattri S.
      • Brunner P.M.
      • Garcet S.
      • Finney R.
      • Cohen S.R.
      • Oliva M.
      • et al.
      Efficacy and safety of ustekinumab treatment in adults with moderate-to-severe atopic dermatitis.
      • Weiss D.
      • Schaschinger M.
      • Ristl R.
      • Gruber R.
      • Kopp T.
      • Stingl G.
      • et al.
      Ustekinumab treatment in severe atopic dermatitis: down-regulation of T-helper 2/22 expression.
      • Saeki H.
      • Kabashima K.
      • Tokura Y.
      • Murata Y.
      • Shiraishi A.
      • Tamamura R.
      • et al.
      Efficacy and safety of ustekinumab in Japanese patients with severe atopic dermatitis: a randomized, double-blind, placebo-controlled, phase II study.
      • Nic Dhonncha E.
      • Clowry J.
      • Dunphy M.
      • Buckley C.
      • Field S.
      • Paul L.
      Treatment of severe atopic dermatitis with ustekinumab: a case series of 10 patients.
      The combination of these common pathomechanisms with other and unique alterations in other signaling systems has been proposed to eventually result in different AD endotypes or disease phenotypes (eg, AD and psoriasis).
      • Guttman-Yassky E.
      • Krueger J.G.
      Atopic dermatitis and psoriasis: two different immune diseases or one spectrum?.
      • Nomura T.
      • Honda T.
      • Kabashima K.
      Multipolarity of cytokine axes in the pathogenesis of atopic dermatitis in terms of age, race, species, disease stage and biomarkers.
      Along with adaptive immunity defects, patients with AD demonstrate a wide range of abnormalities related to the secretion of central epidermal inflammatory mediators. Although some studies have demonstrated increased expression of some antimicrobial peptides (AMPs) in the skin of patients with AD,
      • Harder J.
      • Dressel S.
      • Wittersheim M.
      • Cordes J.
      • Meyer-Hoffert U.
      • Mrowietz U.
      • et al.
      Enhanced expression and secretion of antimicrobial peptides in atopic dermatitis and after superficial skin injury.
      most studies show that although AMPs are abundant in patients with psoriasis, they seem to be present in very low amounts in patients with AD, which might explain the susceptibility of patients with AD to skin microbial infections,
      • Ong P.Y.
      • Ohtake T.
      • Brandt C.
      • Strickland I.
      • Boguniewicz M.
      • Ganz T.
      • et al.
      Endogenous antimicrobial peptides and skin infections in atopic dermatitis.
      • de Jongh G.J.
      • Zeeuwen P.L.
      • Kucharekova M.
      • Pfundt R.
      • van der Valk P.G.
      • Blokx W.
      • et al.
      High expression levels of keratinocyte antimicrobial proteins in psoriasis compared with atopic dermatitis.
      as also seen in our patients. (see Table E3).
      Although TH2-associated cytokines can modulate the expression of AMPs in patients with AD,
      • Nomura I.
      • Goleva E.
      • Howell M.D.
      • Hamid Q.A.
      • Ong P.Y.
      • Hall C.F.
      • et al.
      Cytokine milieu of atopic dermatitis, as compared to psoriasis, skin prevents induction of innate immune response genes.
      • Howell M.D.
      • Boguniewicz M.
      • Pastore S.
      • Novak N.
      • Bieber T.
      • Girolomoni G.
      • et al.
      Mechanism of HBD-3 deficiency in atopic dermatitis.
      regulation of the secretion of these inflammatory mediators has also been shown to be under the direct regulation of CARD14.
      • Fuchs-Telem D.
      • Sarig O.
      • van Steensel M.A.
      • Isakov O.
      • Israeli S.
      • Nousbeck J.
      • et al.
      Familial pityriasis rubra pilaris is caused by mutations in CARD14.
      • Schmitt A.
      • Grondona P.
      • Maier T.
      • Brandle M.
      • Schonfeld C.
      • Jager G.
      • et al.
      MALT1 protease activity controls the expression of inflammatory genes in keratinocytes upon zymosan stimulation.
      Indeed, CARD14-increased activity was found to be associated with increased AMP levels.
      • Mellett M.
      • Meier B.
      • Mohanan D.
      • Schairer R.
      • Cheng P.
      • Satoh T.K.
      • et al.
      CARD14 gain-of-function mutation alone is sufficient to drive IL-23/IL-17-mediated psoriasiform skin inflammation in vivo.
      Here we found that downregulation of CARD14 led to decreased expression of 2 key AMPs that were also found to be less expressed in patient skin (Fig 5).
      AD is considered to result from a combination of immunologic abnormalities and epidermal defects, eventually leading to infections and allergic reactions.
      • Weidinger S.
      • Novak N.
      Atopic dermatitis.
      AMP deficiency not only might underlie infectious complications displayed by patients with AD but could also contribute to other aspects of AD pathogenesis, including impaired epidermal barrier function and mucosal surface immunity. Indeed, AMPs, in addition to their antibacterial and antiviral properties, seem to play an important role in connecting innate and adaptive immune responses, as well as in regulating keratinocyte proliferation and differentiation.
      • Clausen M.L.
      • Agner T.
      Antimicrobial peptides, infections and the skin barrier.
      • Takahashi T.
      • Gallo R.L.
      The critical and multifunctional roles of antimicrobial peptides in dermatology.
      • Chieosilapatham P.
      • Ogawa H.
      • Niyonsaba F.
      Current insights into the role of human beta-defensins in atopic dermatitis.
      • Kiatsurayanon C.
      • Ogawa H.
      • Niyonsaba F.
      The role of host defense peptide human-defensins in the maintenance of skin barriers.
      • Patel S.
      • Homaei A.
      • El-Seedi H.R.
      • Akhtar N.
      Cathepsins: Proteases that are vital for survival but can also be fatal.
      Whether the inflammatory disease seen in the respiratory tracts of our patients also reflects AMP impairment, as opposed to the product of the atopic march alone, is a matter for further studies. CARD14 mutations did not affect LL-37 expression in spite of the fact that NF-κB has been shown to regulate LL-37. This might be because LL-37 expression can be induced through alternative pathways.
      • Nguyen T.T.
      • Niyonsaba F.
      • Ushio H.
      • Akiyama T.
      • Kiatsurayanon C.
      • Smithrithee R.
      • et al.
      Interleukin-36 cytokines enhance the production of host defense peptides psoriasin and LL-37 by human keratinocytes through activation of MAPKs and NF-kappaB.
      hCCL20 expression was also found to be decreased in CARD14-deficient keratinocytes, as well as in keratinocyte cells expressing CARD14 loss-of-function mutations, which is consistent with the fact that hCCL20 expression is increased in keratinocytes exhibiting increased CARD14 expression.
      • Fuchs-Telem D.
      • Sarig O.
      • van Steensel M.A.
      • Isakov O.
      • Israeli S.
      • Nousbeck J.
      • et al.
      Familial pityriasis rubra pilaris is caused by mutations in CARD14.
      Some reports have shown that hCCL20 expression is increased in the sera and skin of patients with AD,
      • Esaki H.
      • Brunner P.M.
      • Renert-Yuval Y.
      • Czarnowicki T.
      • Huynh T.
      • Tran G.
      • et al.
      Early-onset pediatric atopic dermatitis is TH2 but also TH17 polarized in skin.
      but most other studies have shown hCCL20 to be deficient in patients with AD. Because hCCL20 displays antiviral activity, hCCL20 deficiency can underlie the susceptibility of patients with AD to herpesviruses and pox viruses.
      • Schmuth M.
      • Neyer S.
      • Rainer C.
      • Grassegger A.
      • Fritsch P.
      • Romani N.
      • et al.
      Expression of the C-C chemokine MIP-3 alpha/CCL20 in human epidermis with impaired permeability barrier function.
      • Kim B.E.
      • Leung D.Y.
      • Streib J.E.
      • Kisich K.
      • Boguniewicz M.
      • Hamid Q.A.
      • et al.
      Macrophage inflammatory protein 3alpha deficiency in atopic dermatitis skin and role in innate immune response to vaccinia virus.
      More importantly, hCCL20 seems to play an important role in triggering the recruitment of protective inflammatory cells to a compromised epidermis.
      • Schmuth M.
      • Neyer S.
      • Rainer C.
      • Grassegger A.
      • Fritsch P.
      • Romani N.
      • et al.
      Expression of the C-C chemokine MIP-3 alpha/CCL20 in human epidermis with impaired permeability barrier function.
      The decreased expression of this and other inflammatory mediators in the context of severe AD seen in these patients provides a potential model to dissect the primary roles of global inflammatory mediators in patients with psoriasis and some endotypes of AD. How these heterozygous CARD14 mutations interfere with normal signaling is an important topic for future research. The CARD14 homolog CARD11 is known to multimerize with activation
      • Tanner M.J.
      • Hanel W.
      • Gaffen S.L.
      • Lin X.
      CARMA1 coiled-coil domain is involved in the oligomerization and subcellular localization of CARMA1 and is required for T cell receptor-induced NF-kappaB activation.
      ; thus CARD14 deleterious mutations could render heteromultimers inefficient in inducing MALT1 protease activity. Alternatively, CARD14 activity can be dependent on different signaling mechanisms in keratinocytes than those seen in lymphocytes for CARD11.
      It is of interest to note that the Card14−/− mice do not have spontaneous AD.
      • Wang M.
      • Zhang S.
      • Zheng G.
      • Huang J.
      • Songyang Z.
      • Zhao X.
      • et al.
      Gain-of-function mutation of card14 leads to spontaneous psoriasis-like skin inflammation through enhanced keratinocyte response to IL-17A.
      In addition to inherent dissimilarities in keratinocyte biology in mice and human subjects, the lack of triggering microbial exposures can underlie these observations, as was observed in the Relb−/− or Trim32−/− models, which required exposure to a virus or viral product to induce AD.
      • Barton D.
      • HogenEsch H.
      • Weih F.
      Mice lacking the transcription factor RelB develop T cell-dependent skin lesions similar to human atopic dermatitis.
      • Liu Y.
      • Wang Z.
      • De La Torre R.
      • Barling A.
      • Tsujikawa T.
      • Hornick N.
      • et al.
      Trim32 deficiency enhances Th2 immunity and predisposes to features of atopic dermatitis.
      These studies, as well as others pointing to a direct driving effect of abnormal microbial colonization on AD-related inflammation,
      • Kobayashi T.
      • Glatz M.
      • Horiuchi K.
      • Kawasaki H.
      • Akiyama H.
      • Kaplan D.H.
      • et al.
      Dysbiosis and Staphylococcus aureus colonization drives inflammation in atopic dermatitis.
      • Nakatsuji T.
      • Chen T.H.
      • Narala S.
      • Chun K.A.
      • Two A.M.
      • Yun T.
      • et al.
      Antimicrobials from human skin commensal bacteria protect against Staphylococcus aureus and are deficient in atopic dermatitis.
      • Myles I.A.
      • Earland N.J.
      • Anderson E.D.
      • Moore I.N.
      • Kieh M.D.
      • Williams K.W.
      • et al.
      First-in-human topical microbiome transplantation with Roseomonas mucosa for atopic dermatitis.
      provide a potential explanation for variable penetrance of CARD14 mutations and suggest that the lack of host defense genes alone can, in combination with microbial exposure, result in AD-like phenotypes.
      In summary, we have identified germline mutations in CARD14 in patients with severe AD resulting in decreased NF-κB activity and AMP secretion. These data expand the spectrum of CARD14-associated phenotypes and shed new light on the partially overlapping but also distinct pathophysiologic mechanisms underlying AD and psoriasis.
      Clinical implications
      Although upregulation of CARD14 leads to psoriasis, downregulation of the same molecule results in AD and decreased AMP levels, which not only protect the skin against infections but also regulate cutaneous inflammatory circuits.
      We thank our patients and their families for their participation in our studies. Hematoxylin and eosin–stained slides were provided by Dr Ignacio Gonzalez Gomez, Johns Hopkins All Children's Hospital, St Petersburg, Florida. We are thankful to Dr Yinon Ben-Neriah, Hebrew University, Jerusalem, Israel, for the gift of the NF-κB reporter and Dr Anne Bowcock, Imperial College London, London, United Kingdom, for the gift of the CARD14 cDNA construct. This work was supported in part by the Intramural Research Program of the NIAID, NIH.

      Appendix

      Figure thumbnail fx2
      Fig E1siRNA-mediated downregulation of CARD14. Keratinocytes were transfected with CARD14-specific siRNA (siCARD14) or control siRNA (siControl) and then maintained in growth medium (KGM) for 48 hours. A, CARD14 mRNA expression was ascertained by using quantitative RT-PCR. Results represent means ± SEs of 3 independent experiments and are expressed as the percentage of gene expression in primary keratinocytes transfected with CARD14-specific siRNA relative to gene expression in siRNA control–transfected cells. ***P < .001, 2-sided t test. Results are normalized to GAPDH RNA levels. B, CARD14 protein expression was ascertained by using immunoblotting with an anti-CARD14 antibody (CARD14). β-Actin (ACTIN) served as a loading control.
      Figure thumbnail fx3
      Fig E2Dominant negative effect of AD-associated mutations in CARD14. HEK293 cells were cotransfected with an NF-κB–responsive luciferase reporter and a combination of an empty vector or the same vector carrying either the wild-type CARD14 cDNA sequence or the CARD14 cDNA sequence harboring the p.I593T or p.N737H mutations. The amount of each expression vector used in each combination is given below the graph. The total amount of transfected DNA was kept at 50 ng. Luciferase activity was measured 24 hours after transfection and normalized to Renilla luciferase activity. Results represent means ± SDs of 3 independent experiments. Results were statistically tested against luciferase activity recorded on transfection of 50 ng of wild-type CARD14 cDNA (*) or against luciferase activity recorded on transfection of 25 ng of wild-type CARD14 cDNA and 25 ng of nonempty vector DNA (#). ###P < .001 and ***P < .001, 2-sided t test.
      Figure thumbnail fx4
      Fig E3Inflammatory gene expression in CARD14-deficient keratinocytes. Keratinocytes were transfected with CARD14-specific siRNA (siCARD14) or control siRNA (siControl) and then maintained in growth medium (KGM) without supplements for 48 hours. Real-time PCR analysis was used to assess RNA expression of DEFB1 encoding hBD-1, DEFB2 encoding hBD-2, CAMP encoding LL-37, and CCL20 encoding hCCL20. Results are expressed as the percentage of RNA expression relative to expression in control siRNA-transfected samples ± SE. Results represent the mean of 3 independent experiments. *P < .05 and ****P < .0001, 2-sided t test.
      Figure thumbnail fx5
      Fig E4IL-33 and TSLP expression in keratinocytes expressing CARD14 loss-of-function mutations. Keratinocytes were transfected with wild-type (WT) or mutant CARD14 (p.I593T or p.N737H) cDNA constructs and then maintained in growth medium (KGM) without supplements for 48 hours. Protein levels of TSLP secreted into culture medium or IL-33 in cell lysate were measured by using ELISA assays, according to the manufacturer's instructions. Results are expressed as the percentage of protein expression levels relative to expression in wild-type CARD14-transfected samples ± SE. Results represent the mean of 3 independent experiments.
      Table E1Oligonucleotides used to sequence CARD14
      ExonsForward oligonucleotide sequenceReverse oligonucleotide sequenceExpected product size (bp)
      2TTAAAACGGTGTCACCCTGACAGGACGAGAAGAGACCCC404
      3CGATTCTTACATGTGCGGGGGCACCTGGGGTTACCAG331
      4ACCTGCTCACCTACCCACCGACAAGGAAGAGGGGAAAGG506
      5TTAGGTGAACCCTTTCGTGGACCTGTCAGAAACCCCACAG402
      6AAGACTGCATCCGTCCACACATCTGGCTTCCCCACAGAC320
      7AACTGTCTCCCTCCCTCCACGAGACTGTCCCCGGAACC303
      8GGCTAGAAACAGGGCTCTCCCTGGAGCCCAGCTCTGTC308
      9ACCTGGTAGAAACTCCACGGCAGGGAAGAGGTTGGTACGA315
      10-11CTGTGGCTCTCTCTACACCGTTCTATCTGCCCTTTCCCTG659
      12-13GATCTGTGAAGAAGGGGCTGGTGAAGTCTGCCTGGGTCAC671
      14GTGCAGGCAGTGGTCCTACAACCACCAGGGACTTAAGGG323
      15ATTTTCTGCAACCTTCCTCGCCACGCCCACCCTCTATTG419
      16ACTCTCCCCTGCTCGGCACTCTCCACACAGTGCCTCC237
      17ATCATCTCCCCTGAATTCCCACTAGCAGCAGCTCCCAAAG263
      18AGCAAAGCAGACCCAGTCCGGGGAGGGAAGGAGGAG364
      19GGGGACAGGGGTGTTTACCAGGTCACCCAGGTCTCAGG315
      20CTTCTGACCTGGGCGTTGCAAACCGCAGAGCACACTC294
      21TGTTTAGGGGTGTTTGGGTGCTGGGCTGAGGAACAGGAC382
      Table E2Oligonucleotides used to perform quantitative RT-PCR
      GeneForward oligonucleotide sequenceReverse oligonucleotide sequenceExpected product size (bp)
      CARD14AGGCAGGTGTTCGAGCTGGGTCCTGGCTTCCTGCTT102
      DEFB1GGAGGGCAATGTCTCTATTCTGTCATTTCACTTCTGCGTCATTTC127
      DEFB2TTAAGGCAGGTAACAGGATCGCTCCTCTTCTCGTTCCTCTTCATATTC82
      CAMPTGTGCTTCGTGCTATAGATGGGCACACTGTCTCCTTCACTG145
      CCL20GGTGAAATATATTGTGCGTCTCCACTAAACCCTCCATGATGTGC148
      GAPDHGAGTCAACGGATTTGGTCGTGACAAGCTTCCCGTTCTCAGCC185
      Table E3Clinical features of members of families 1 to 3
      PatientCARD14 genotypeADAllergic rhinitisAsthmaFood allergyPyogenic skin infectionsViral skin infectionsRespiratory tract infectionsSCORAD scoreOthers
      Family 1: I-1WT/WT+
      +, Mild; ++, moderate; +++, severe.
      +++NA
      Family 1: I-2WT/I593T+++++++++++NA
      Family 1: II-1WT/I593T+++++++++++++67Short stature, precocious puberty (caused by chronic oral steroid use?)
      Family 2: I-1Unknown
      Family 2: I-2WT/WT
      Family 2: II-1WT/I593T++++++++++60-70Vitiligo, alopecia
      Family 3: I-1WT/N737H++++++++NA
      Family 3: I-2WT/WT
      Family 3: I-3Unknown
      Family 3: I-4Unknown
      Family 3: II-1WT/N737H+++++++++++++++++60-72Extremity osteomyelitis, recurrent paronychia, nontraumatic fracture, and retained primary teeth
      Family 3: II-2Unknown+++NA
      Family 3: II-3Unknown++++NA
      Family 3: II-4Unknown++
      NA, Not available; WT, wild-type.
      +, Mild; ++, moderate; +++, severe.
      Table E4Rare immune-related variations found through whole-exome sequencing analysis
      GeneChromosomePositionReference alleleAlternative alleleMAFGenotyping
      Family 1: II-1Family 3: II-1
      JAK1165321300GA4.16E-05G/AG/G
      BEND36107391391AG0A/GA/A
      IKZF1750467806GA0G/AG/G
      DOCK89368288GTAC0GT/ACGT/GT
      SLC29A31073115941TGCA0CA/CATG/TG
      PSMA31458737688TC8.52E-06T/CT/T
      CARD141778172317TC4.978E-06T/CT/T
      SON2134922824GCG0GC/GGC/GC
      TLR8X12937536AC0A/CA/A
      NOD21650733636TC0T/TT/C
      PLCG21681973641AG4.14E-05A/AA/G
      CARD141778176209AC8.741E-05A/AA/C
      G6PC31742148520AC0.0003A/AA/C
      TREX2X152710624GA0.0003G/GG/A
      MAF, Minor allele frequency.
      Table E5Bioinformatics analysis of CARD14 mutations
      MutationPolyphen2 (range, 0-1)
      http://genetics.bwh.harvard.edu/pph2/index.shtml.E1
      SIFT (range, 1-0)
      http://sift.jcvi.org/www/SIFT_enst_submit.html.E2
      ConSurf (range, 1-9)
      http://consurf.tau.ac.il/2016/.E3
      Mutation

      Taster
      http://www.mutationtaster.org/index.html.E4
      SNAP
      https://www.rostlab.org/services/SNAP/.E5
      Allele frequency
      http://gnomad.broadinstitute.org/gene/ENSG00000141527.E6
      p.I593T0.9990.59Disease causingPathogenic4.078e-6
      p.N737H0.9930.018Disease causingPathogenic8.741e-5
      http://genetics.bwh.harvard.edu/pph2/index.shtml.
      • Adzhubei I.A.
      • Schmidt S.
      • Peshkin L.
      • Ramensky V.E.
      • Gerasimova A.
      • Bork P.
      • et al.
      A method and server for predicting damaging missense mutations.
      http://sift.jcvi.org/www/SIFT_enst_submit.html.
      • Kumar P.
      • Henikoff S.
      • Ng P.C.
      Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm.
      http://consurf.tau.ac.il/2016/.
      • Ashkenazy H.
      • Erez E.
      • Martz E.
      • Pupko T.
      • Ben-Tal N.
      ConSurf 2010: calculating evolutionary conservation in sequence and structure of proteins and nucleic acids.
      § http://www.mutationtaster.org/index.html.
      • Schwarz J.M.
      • Cooper D.N.
      • Schuelke M.
      • Seelow D.
      MutationTaster2: mutation prediction for the deep-sequencing age.
      https://www.rostlab.org/services/SNAP/.
      • Hecht M.
      • Bromberg Y.
      • Rost B.
      Better prediction of functional effects for sequence variants.
      http://gnomad.broadinstitute.org/gene/ENSG00000141527.
      • Lek M.
      • Karczewski K.J.
      • Minikel E.V.
      • Samocha K.E.
      • Banks E.
      • Fennell T.
      • et al.
      Analysis of protein-coding genetic variation in 60,706 humans.

      References

        • Weidinger S.
        • Novak N.
        Atopic dermatitis.
        Lancet. 2016; 387: 1109-1122
        • Otsuka A.
        • Nomura T.
        • Rerknimitr P.
        • Seidel J.A.
        • Honda T.
        • Kabashima K.
        The interplay between genetic and environmental factors in the pathogenesis of atopic dermatitis.
        Immunol Rev. 2017; 278: 246-262
        • Kim B.E.
        • Leung D.Y.M.
        Significance of skin barrier dysfunction in atopic dermatitis.
        Allergy Asthma Immunol Res. 2018; 10: 207-215
        • Paternoster L.
        • Standl M.
        • Waage J.
        • Baurecht H.
        • Hotze M.
        • Strachan D.P.
        • et al.
        Multi-ancestry genome-wide association study of 21,000 cases and 95,000 controls identifies new risk loci for atopic dermatitis.
        Nat Genet. 2015; 47: 1449-1456
        • Ferreira M.A.R.
        • Vonk J.M.
        • Baurecht H.
        • Marenholz I.
        • Tian C.
        • Hoffman J.D.
        • et al.
        Eleven loci with new reproducible genetic associations with allergic disease risk.
        J Allergy Clin Immunol. 2018; ([Epub ahead of print])
        • Irvine A.D.
        • McLean W.H.
        • Leung D.Y.
        Filaggrin mutations associated with skin and allergic diseases.
        N Engl J Med. 2011; 365: 1315-1327
        • Ellinghaus D.
        • Baurecht H.
        • Esparza-Gordillo J.
        • Rodriguez E.
        • Matanovic A.
        • Marenholz I.
        • et al.
        High-density genotyping study identifies four new susceptibility loci for atopic dermatitis.
        Nat Genet. 2013; 45: 808-812
        • Peltonen L.
        • Perola M.
        • Naukkarinen J.
        • Palotie A.
        Lessons from studying monogenic disease for common disease.
        Hum Mol Genet. 2006; 15: R67-R74
        • Lyons J.J.
        • Milner J.D.
        Primary atopic disorders.
        J Exp Med. 2018; 215: 1009-1022
        • Ma C.A.
        • Stinson J.R.
        • Zhang Y.
        • Abbott J.K.
        • Weinreich M.A.
        • Hauk P.J.
        • et al.
        Germline hypomorphic CARD11 mutations in severe atopic disease.
        Nat Genet. 2017; 49: 1192-1201
        • Hirota T.
        • Takahashi A.
        • Kubo M.
        • Tsunoda T.
        • Tomita K.
        • Sakashita M.
        • et al.
        Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population.
        Nat Genet. 2012; 44: 1222-1226
        • Jordan C.T.
        • Cao L.
        • Roberson E.D.
        • Pierson K.C.
        • Yang C.F.
        • Joyce C.E.
        • et al.
        PSORS2 is due to mutations in CARD14.
        Am J Hum Genet. 2012; 90: 784-795
        • Fuchs-Telem D.
        • Sarig O.
        • van Steensel M.A.
        • Isakov O.
        • Israeli S.
        • Nousbeck J.
        • et al.
        Familial pityriasis rubra pilaris is caused by mutations in CARD14.
        Am J Hum Genet. 2012; 91: 163-170
        • Jordan C.T.
        • Cao L.
        • Roberson E.D.
        • Duan S.
        • Helms C.A.
        • Nair R.P.
        • et al.
        Rare and common variants in CARD14, encoding an epidermal regulator of NF-kappaB, in psoriasis.
        Am J Hum Genet. 2012; 90: 796-808
        • Li Q.
        • Jin Chung H.
        • Ross N.
        • Keller M.
        • Andrews J.
        • Kingman J.
        • et al.
        Analysis of CARD14 polymorphisms in pityriasis rubra pilaris: activation of NF-κB.
        J Invest Dermatol. 2015; 135: 1905-1908
        • Berki D.M.
        • Liu L.
        • Choon S.E.
        • David Burden A.
        • Griffiths C.E.M.
        • Navarini A.A.
        • et al.
        Activating CARD14 mutations are associated with generalized pustular psoriasis but rarely account for familial recurrence in psoriasis vulgaris.
        J Invest Dermatol. 2015; 135: 2964-2970
        • Howes A.
        • O'Sullivan P.A.
        • Breyer F.
        • Ghose A.
        • Cao L.
        • Krappmann D.
        • et al.
        Psoriasis mutations disrupt CARD14 autoinhibition promoting BCL10-MALT1-dependent NF-kappaB activation.
        Biochem J. 2016; 473: 1759-1768
        • Li H.
        • Durbin R.
        Fast and accurate long-read alignment with Burrows-Wheeler transform.
        Bioinformatics. 2010; 26: 589-595
        • McKenna A.
        • Hanna M.
        • Banks E.
        • Sivachenko A.
        • Cibulskis K.
        • Kernytsky A.
        • et al.
        The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data.
        Genome Res. 2010; 20: 1297-1303
        • Wang K.
        • Li M.
        • Hakonarson H.
        ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data.
        Nucleic Acids Res. 2010; 38: e164
        • Adzhubei I.A.
        • Schmidt S.
        • Peshkin L.
        • Ramensky V.E.
        • Gerasimova A.
        • Bork P.
        • et al.
        A method and server for predicting damaging missense mutations.
        Nat Methods. 2010; 7: 248-249
        • Kumar P.
        • Henikoff S.
        • Ng P.C.
        Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm.
        Nat Protoc. 2009; 4: 1073-1081
        • Samuelov L.
        • Sarig O.
        • Harmon R.M.
        • Rapaport D.
        • Ishida-Yamamoto A.
        • Isakov O.
        • et al.
        Desmoglein 1 deficiency results in severe dermatitis, multiple allergies and metabolic wasting.
        Nat Genet. 2013; 45: 1244-1248
        • Jiang C.
        • Lin X.
        Regulation of NF-κB by the CARD proteins.
        Immunol Rev. 2012; 246: 141-153
        • Jun J.E.
        • Wilson L.E.
        • Vinuesa C.G.
        • Lesage S.
        • Blery M.
        • Miosge L.A.
        • et al.
        Identifying the MAGUK protein Carma-1 as a central regulator of humoral immune responses and atopy by genome-wide mouse mutagenesis.
        Immunity. 2003; 18: 751-762
        • Akiyama M.
        • Takeichi T.
        • McGrath J.A.
        • Sugiura K.
        Autoinflammatory keratinization diseases.
        J Allergy Clin Immunol. 2017; 140: 1545-1547
        • Biedermann T.
        • Rocken M.
        • Carballido J.M.
        TH1 and TH2 lymphocyte development and regulation of TH cell-mediated immune responses of the skin.
        J Investig Dermatol Symp Proc. 2004; 9: 5-14
        • Sidler D.
        • Wu P.
        • Herro R.
        • Claus M.
        • Wolf D.
        • Kawakami Y.
        • et al.
        TWEAK mediates inflammation in experimental atopic dermatitis and psoriasis.
        Nat Commun. 2017; 8: 15395
        • Guttman-Yassky E.
        • Krueger J.G.
        Atopic dermatitis and psoriasis: two different immune diseases or one spectrum?.
        Curr Opin Immunol. 2017; 48: 68-73
        • Brunner P.M.
        • Guttman-Yassky E.
        • Leung D.Y.
        The immunology of atopic dermatitis and its reversibility with broad-spectrum and targeted therapies.
        J Allergy Clin Immunol. 2017; 139: S65-S76
        • Girolomoni G.
        • Strohal R.
        • Puig L.
        • Bachelez H.
        • Barker J.
        • Boehncke W.H.
        • et al.
        The role of IL-23 and the IL-23/TH 17 immune axis in the pathogenesis and treatment of psoriasis.
        J Eur Acad Dermatol Venereol. 2017; 31: 1616-1626
        • Nomura T.
        • Honda T.
        • Kabashima K.
        Multipolarity of cytokine axes in the pathogenesis of atopic dermatitis in terms of age, race, species, disease stage and biomarkers.
        Int Immunol. 2018; 30: 419-428
        • Brunner P.M.
        • Israel A.
        • Zhang N.
        • Leonard A.
        • Wen H.C.
        • Huynh T.
        • et al.
        Early-onset pediatric atopic dermatitis is characterized by TH2/TH17/TH22-centered inflammation and lipid alterations.
        J Allergy Clin Immunol. 2018; 141: 2094-2106
        • Khattri S.
        • Brunner P.M.
        • Garcet S.
        • Finney R.
        • Cohen S.R.
        • Oliva M.
        • et al.
        Efficacy and safety of ustekinumab treatment in adults with moderate-to-severe atopic dermatitis.
        Exp Dermatol. 2017; 26: 28-35
        • Weiss D.
        • Schaschinger M.
        • Ristl R.
        • Gruber R.
        • Kopp T.
        • Stingl G.
        • et al.
        Ustekinumab treatment in severe atopic dermatitis: down-regulation of T-helper 2/22 expression.
        J Am Acad Dermatol. 2017; 76: 91-97.e3
        • Saeki H.
        • Kabashima K.
        • Tokura Y.
        • Murata Y.
        • Shiraishi A.
        • Tamamura R.
        • et al.
        Efficacy and safety of ustekinumab in Japanese patients with severe atopic dermatitis: a randomized, double-blind, placebo-controlled, phase II study.
        Br J Dermatol. 2017; 177: 419-427
        • Nic Dhonncha E.
        • Clowry J.
        • Dunphy M.
        • Buckley C.
        • Field S.
        • Paul L.
        Treatment of severe atopic dermatitis with ustekinumab: a case series of 10 patients.
        Br J Dermatol. 2017; 177: 1752-1753
        • Harder J.
        • Dressel S.
        • Wittersheim M.
        • Cordes J.
        • Meyer-Hoffert U.
        • Mrowietz U.
        • et al.
        Enhanced expression and secretion of antimicrobial peptides in atopic dermatitis and after superficial skin injury.
        J Invest Dermatol. 2010; 130: 1355-1364
        • Ong P.Y.
        • Ohtake T.
        • Brandt C.
        • Strickland I.
        • Boguniewicz M.
        • Ganz T.
        • et al.
        Endogenous antimicrobial peptides and skin infections in atopic dermatitis.
        N Engl J Med. 2002; 347: 1151-1160
        • de Jongh G.J.
        • Zeeuwen P.L.
        • Kucharekova M.
        • Pfundt R.
        • van der Valk P.G.
        • Blokx W.
        • et al.
        High expression levels of keratinocyte antimicrobial proteins in psoriasis compared with atopic dermatitis.
        J Invest Dermatol. 2005; 125: 1163-1173
        • Nomura I.
        • Goleva E.
        • Howell M.D.
        • Hamid Q.A.
        • Ong P.Y.
        • Hall C.F.
        • et al.
        Cytokine milieu of atopic dermatitis, as compared to psoriasis, skin prevents induction of innate immune response genes.
        J Immunol. 2003; 171: 3262-3269
        • Howell M.D.
        • Boguniewicz M.
        • Pastore S.
        • Novak N.
        • Bieber T.
        • Girolomoni G.
        • et al.
        Mechanism of HBD-3 deficiency in atopic dermatitis.
        Clin Immunol. 2006; 121: 332-338
        • Schmitt A.
        • Grondona P.
        • Maier T.
        • Brandle M.
        • Schonfeld C.
        • Jager G.
        • et al.
        MALT1 protease activity controls the expression of inflammatory genes in keratinocytes upon zymosan stimulation.
        J Invest Dermatol. 2016; 136: 788-797
        • Mellett M.
        • Meier B.
        • Mohanan D.
        • Schairer R.
        • Cheng P.
        • Satoh T.K.
        • et al.
        CARD14 gain-of-function mutation alone is sufficient to drive IL-23/IL-17-mediated psoriasiform skin inflammation in vivo.
        J Invest Dermatol. 2018; 138: 2010-2023
        • Clausen M.L.
        • Agner T.
        Antimicrobial peptides, infections and the skin barrier.
        Curr Probl Dermatol. 2016; 49: 38-46
        • Takahashi T.
        • Gallo R.L.
        The critical and multifunctional roles of antimicrobial peptides in dermatology.
        Dermatol Clin. 2017; 35: 39-50
        • Chieosilapatham P.
        • Ogawa H.
        • Niyonsaba F.
        Current insights into the role of human beta-defensins in atopic dermatitis.
        Clin Exp Immunol. 2017; 190: 155-166
        • Kiatsurayanon C.
        • Ogawa H.
        • Niyonsaba F.
        The role of host defense peptide human-defensins in the maintenance of skin barriers.
        Curr Pharm Des. 2018; 24: 1092-1099
        • Patel S.
        • Homaei A.
        • El-Seedi H.R.
        • Akhtar N.
        Cathepsins: Proteases that are vital for survival but can also be fatal.
        Biomed Pharmacother. 2018; 105: 526-532
        • Nguyen T.T.
        • Niyonsaba F.
        • Ushio H.
        • Akiyama T.
        • Kiatsurayanon C.
        • Smithrithee R.
        • et al.
        Interleukin-36 cytokines enhance the production of host defense peptides psoriasin and LL-37 by human keratinocytes through activation of MAPKs and NF-kappaB.
        J Dermatol Sci. 2012; 68: 63-66
        • Esaki H.
        • Brunner P.M.
        • Renert-Yuval Y.
        • Czarnowicki T.
        • Huynh T.
        • Tran G.
        • et al.
        Early-onset pediatric atopic dermatitis is TH2 but also TH17 polarized in skin.
        J Allergy Clin Immunol. 2016; 138: 1639-1651
        • Schmuth M.
        • Neyer S.
        • Rainer C.
        • Grassegger A.
        • Fritsch P.
        • Romani N.
        • et al.
        Expression of the C-C chemokine MIP-3 alpha/CCL20 in human epidermis with impaired permeability barrier function.
        Exp Dermatol. 2002; 11: 135-142
        • Kim B.E.
        • Leung D.Y.
        • Streib J.E.
        • Kisich K.
        • Boguniewicz M.
        • Hamid Q.A.
        • et al.
        Macrophage inflammatory protein 3alpha deficiency in atopic dermatitis skin and role in innate immune response to vaccinia virus.
        J Allergy Clin Immunol. 2007; 119: 457-463
        • Tanner M.J.
        • Hanel W.
        • Gaffen S.L.
        • Lin X.
        CARMA1 coiled-coil domain is involved in the oligomerization and subcellular localization of CARMA1 and is required for T cell receptor-induced NF-kappaB activation.
        J Biol Chem. 2007; 282: 17141-17147
        • Wang M.
        • Zhang S.
        • Zheng G.
        • Huang J.
        • Songyang Z.
        • Zhao X.
        • et al.
        Gain-of-function mutation of card14 leads to spontaneous psoriasis-like skin inflammation through enhanced keratinocyte response to IL-17A.
        Immunity. 2018; 49: 66-79.e5
        • Barton D.
        • HogenEsch H.
        • Weih F.
        Mice lacking the transcription factor RelB develop T cell-dependent skin lesions similar to human atopic dermatitis.
        Eur J Immunol. 2000; 30: 2323-2332
        • Liu Y.
        • Wang Z.
        • De La Torre R.
        • Barling A.
        • Tsujikawa T.
        • Hornick N.
        • et al.
        Trim32 deficiency enhances Th2 immunity and predisposes to features of atopic dermatitis.
        J Invest Dermatol. 2017; 137: 359-366
        • Kobayashi T.
        • Glatz M.
        • Horiuchi K.
        • Kawasaki H.
        • Akiyama H.
        • Kaplan D.H.
        • et al.
        Dysbiosis and Staphylococcus aureus colonization drives inflammation in atopic dermatitis.
        Immunity. 2015; 42: 756-766
        • Nakatsuji T.
        • Chen T.H.
        • Narala S.
        • Chun K.A.
        • Two A.M.
        • Yun T.
        • et al.
        Antimicrobials from human skin commensal bacteria protect against Staphylococcus aureus and are deficient in atopic dermatitis.
        Sci Transl Med. 2017; 9
        • Myles I.A.
        • Earland N.J.
        • Anderson E.D.
        • Moore I.N.
        • Kieh M.D.
        • Williams K.W.
        • et al.
        First-in-human topical microbiome transplantation with Roseomonas mucosa for atopic dermatitis.
        JCI Insight. 2018; 3

      Linked Article

      • Aberrant CARD14 function might cause defective barrier formation
        Journal of Allergy and Clinical ImmunologyVol. 143Issue 4
        • Preview
          We read with great interest the recent report by Peled et al1 on how loss-of-function mutations in CARD14 (caspase recruitment domain family, member 14) are associated with a severe variant of atopic dermatitis (AD).1 CARD14 encodes a known regulator of nuclear factor kappa-light-chain enhancer of activated B cells (NF-κB), and dominant gain-of-function mutations in CARD14 cause psoriasis and related disorders.1,2 Peled et al1 revealed that dominant negative mutations in CARD14 result in severe AD and decreased NF-κB signaling.
        • Full-Text
        • PDF