Advertisement

Filaggrin mutations, atopic eczema, hay fever, and asthma in children

Published:April 07, 2008DOI:https://doi.org/10.1016/j.jaci.2008.02.014

      Background

      Mutations in the filaggrin gene (FLG) have been shown to play a significant role in ichthyosis vulgaris and eczema, 2 common chronic skin diseases. However, their role in the development of other atopic diseases such as asthma and rhinitis has not yet been clarified in large population-based studies.

      Objectives

      To study the effect of FLG mutations at the population level and their effect on other atopic phenotypes.

      Methods

      Association analysis of the 2 common FLG-null mutations R501X and 2282del4 and 3 recently identified rare FLG variants (R2447X, S3247X, 3702delG) was performed on our cross-sectional population of German children (n = 3099) recruited as part of the International Study of Asthma and Allergies in Childhood II in Munich (n = 1159) and Dresden (n = 1940).

      Results

      FLG variants increased the risk for eczema more than 3-fold (odds ratio [OR], 3.12; 95% CI, 2.33-4.173; P = 2.5 × 10−14; population-attributable risk, 13.5%). Independent of eczema, FLG mutations conferred a substantial risk for allergic rhinitis (OR, 2.64; 95% CI, 1.76-4.00; P = 2.5 × 10−6; population-attributable risk, 10.8%). Nasal biopsies demonstrated strong filaggrin expression in the cornified epithelium of the nasal vestibular lining, but not the transitional and respiratory nasal epithelia. In contrast, the association with asthma (OR, 1.79; 95% CI, 1.19-2.68; P = .0048) was restricted to asthma occurring in the context of eczema, and there was a strong association with the complex phenotype eczema plus asthma (OR, 3.49; 95% CI, 2.00-6.08; P = 1.0 × 10−5).

      Conclusion

      Our results suggest that FLG mutations are key organ specific factors predominantly affecting the development of eczema and confer significant risks of allergic sensitization and allergic rhinitis as well as asthma in the context of eczema.

      Key words

      Abbreviations used:

      EDC (Epidermal differentiation complex), FLG (Filaggrin gene), HWE (Hardy-Weinberg equilibrium), ISAAC II (International Study of Asthma and Allergies in Childhood, phase II), OR (Odds ratio), PAR (Population-attributable risk), SPT (Skin prick test)
      Recently a breakthrough in the genetics of atopic eczema was achieved by the identification of 2 mutations (R501X and 2282del4) within the filaggrin gene (FLG).
      • Smith F.J.
      • Irvine A.D.
      • Terron-Kwiatkowski A.
      • Sandilands A.
      • Campbell L.E.
      • Zhao Y.
      • et al.
      Loss-of-function mutations in the gene encoding filaggrin cause ichthyosis vulgaris.
      • Palmer C.N.
      • Irvine A.D.
      • Terron-Kwiatkowski A.
      • Zhao Y.
      • Liao H.
      • Lee S.P.
      • et al.
      Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis.
      Both mutations lead to a premature translation stop of the filaggrin protein, resulting in a filaggrin deficiency. Further rare FLG mutations reported in Irish subjects have also been shown to be functional null alleles.
      • Sandilands A.
      • Terron-Kwiatkowski A.
      • Hull P.R.
      • O'Regan G.M.
      • Clayton T.H.
      • Watson R.M.
      • et al.
      Comprehensive analysis of the gene encoding filaggrin uncovers prevalent and rare mutations in ichthyosis vulgaris and atopic eczema.
      A substantial proportion of the white population may have a primary barrier dysfunction caused by a genetic filaggrin deficiency and thereby be prone to developing inflammatory skin diseases.
      • Irvine A.D.
      • McLean W.H.
      Breaking the (un)sound barrier: filaggrin is a major gene for atopic dermatitis.
      Although FLG mutations cause ichthyosis vulgaris, one of the most common inherited cutaneous keratinization disorders, they also represent a major predisposing factor for atopic eczema.
      • Smith F.J.
      • Irvine A.D.
      • Terron-Kwiatkowski A.
      • Sandilands A.
      • Campbell L.E.
      • Zhao Y.
      • et al.
      Loss-of-function mutations in the gene encoding filaggrin cause ichthyosis vulgaris.
      • Palmer C.N.
      • Irvine A.D.
      • Terron-Kwiatkowski A.
      • Zhao Y.
      • Liao H.
      • Lee S.P.
      • et al.
      Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis.
      Independent replication studies have provided unequivocal evidence for the exceptionally strong and consistent effect of FLG null alleles on white populations, predisposing particularly to an early-onset, severe, and persistent course of eczema.
      • Baurecht H.
      • Irvine A.D.
      • Novak N.
      • Illig T.
      • Buhler B.
      • Ring J.
      • et al.
      Toward a major risk factor for atopic eczema: meta-analysis of filaggrin polymorphism data.
      These initial family-based and case-control studies were all centered on the effect of FLG in patients with eczema, whereas so far, the incidence of FLG null alleles in the general population and their role in atopic diseases other than eczema has not been determined sufficiently. The expression of filaggrin in the skin and other keratinizing epithelia such as the oral cavity and the conjunctiva
      • Krenzer K.L.
      • Freddo T.F.
      Cytokeratin expression in normal human bulbar conjunctiva obtained by impression cytology.
      • Presland R.B.
      • Dale B.A.
      Epithelial structural proteins of the skin and oral cavity: function in health and disease.
      • De Benedetto A.
      • Qualia C.M.
      • Baroody F.M.
      • Beck L.A.
      Filaggrin expression in oral, nasal, and esophageal mucosa.
      may suggest that organs in addition to the skin could be affected by FLG mutations.
      We genotyped 3099 German children from the population-based cross-sectional International Study of Asthma and Atopy in Childhood, phase II (ISAAC II) for 5 FLG variants previously described to reach a minor allele frequency of at least 0.01 in a study of Irish subjects
      • Sandilands A.
      • Terron-Kwiatkowski A.
      • Hull P.R.
      • O'Regan G.M.
      • Clayton T.H.
      • Watson R.M.
      • et al.
      Comprehensive analysis of the gene encoding filaggrin uncovers prevalent and rare mutations in ichthyosis vulgaris and atopic eczema.
      : the originally identified mutations in FLG repeat 1, R501X and 2282del4, as well as the more 3′ mutations R2447X, S3247X, and 3702delG. The role of FLG mutations in the manifestation of a range of atopic diseases such as eczema, asthma, and rhinitis was studied. Furthermore, the probability that a person carrying these mutations will develop an atopic disease (penetrance) and the proportion of cases in the population attributable to the mutant FLG alleles (population-attributable risk PAR) were determined.

      Methods

       Nomenclature

      The terminology for atopic diseases is confusing, and terms such as atopic eczema, atopic dermatitis, childhood eczema, atopiform dermatitis, and flexural dermatitis are frequently used synonymously in the literature. In an attempt to standardize the nosology for allergic diseases, the nomenclature committee of the World Allergy Organization recently published its recommendation for naming allergic diseases such as asthma, eczema, and rhinitis.
      • Johansson S.G.
      • Bieber T.
      • Dahl R.
      • Friedmann P.S.
      • Lanier B.Q.
      • Lockey R.F.
      • et al.
      Revised nomenclature for allergy for global use: report of the Nomenclature Review Committee of the World Allergy Organization, October 2003.
      In this article, we try to follow these recommendations, although this study was performed before the World Allergy Organization suggestions.

       Study population and phenotyping

      Between 1995 and 1996, a cross-sectional study was performed in Munich and Dresden, Germany,
      • Weiland S.K.
      • von Mutius E.
      • Hirsch T.
      • Duhme H.
      • Fritzsch C.
      • Werner B.
      • et al.
      Prevalence of respiratory and atopic disorders among children in the East and West of Germany five years after unification.
      as part of ISAAC II to assess the prevalence of asthma and allergies in all schoolchildren attending 4th class in both cities (age 9-11 years) using standardized and validated study tools.
      • Weiland S.K.
      • von Mutius E.
      • Hirsch T.
      • Duhme H.
      • Fritzsch C.
      • Werner B.
      • et al.
      Prevalence of respiratory and atopic disorders among children in the East and West of Germany five years after unification.
      • Jenkins M.A.
      • Clarke J.R.
      • Carlin J.B.
      • Robertson C.F.
      • Hopper J.L.
      • Dalton M.F.
      • et al.
      Validation of questionnaire and bronchial hyperresponsiveness against respiratory physician assessment in the diagnosis of asthma.
      • Williams H.C.
      • Burney P.G.
      • Pembroke A.C.
      • Hay R.J.
      Validation of the U.K. diagnostic criteria for atopic dermatitis in a population setting. U.K. Diagnostic Criteria for Atopic Dermatitis Working Party.
      • Braun-Fahrlander C.
      • Wuthrich B.
      • Gassner M.
      • Grize L.
      • Sennhauser F.H.
      • Varonier H.S.
      • et al.
      Validation of a rhinitis symptom questionnaire (ISAAC core questions) in a population of Swiss school children visiting the school health services. SCARPOL-team. Swiss Study on Childhood Allergy and Respiratory Symptom with respect to Air Pollution and Climate. International Study of Asthma and Allergies in Childhood.
      Within the study population of 5629 children, all children of German origin with DNA available from Munich (n = 1159) and Dresden (n = 1940) were included in this analysis (n = 3099).
      Skin tests and serum measurements for total and specific IgE were performed according to standardized procedures as previously described.
      • Weiland S.K.
      • von Mutius E.
      • Hirsch T.
      • Duhme H.
      • Fritzsch C.
      • Werner B.
      • et al.
      Prevalence of respiratory and atopic disorders among children in the East and West of Germany five years after unification.
      Skin prick tests (SPTs) to 6 common aeroallergens (Dermatophagoides pteronyssinus, Dermatophagoides farinae, Alternaria tenuis, cat dander, mixed grass, and tree pollen, all from ALK-Scherax, Wedel, Germany) were performed. A child was considered atopic if a wheal reaction ≥3 mm occurred to 1 or more allergens after subtraction of the negative control. Specific IgE antibodies against a panel of aeroallergens (Sx1 CAP from Phadia, Freiburg, Germany) and food allergens (FX5 CAP; Phadia) were measured in a range between 0.35 and 100 IU/mL.
      Children whose parents reported a physician's diagnosis of endogenous or atopic dermatitis were classified as having eczema. Children whose parents reported a physician's diagnosis of asthma (at least once) or of spastic bronchitis or recurrent asthmatic bronchitis (at least twice) in a self-administered questionnaire were classified as having asthma. The definition of allergic rhinitis was based on the parent's information of a doctor's diagnosis of hay fever in combination with a positive SPT against at least 1 of the allergens tested.
      Eczema and asthma were divided into atopic and nonatopic on the basis of positive SPTs against at least 1 of the allergens tested. Current allergic rhinitis symptoms was defined as the parent's report of an itchy runny nose and sneezing in the last 12 months in the absence of a cold.
      The following subphenotypes of eczema were analyzed: visible eczema, defined according to standardized and validated criteria at inspection determined by a trained pediatrician
      • Williams H.C.
      • Forsdyke H.
      • Boodoo G.
      • Hay R.J.
      • Burney P.G.
      A protocol for recording the sign of flexural dermatitis in children.
      ; and current eczema symptoms, defined as parent's report of the presence of an itchy rash in the last 12 months that had affected the skin creases.
      Written informed consent was obtained from all parents of children included in the study. All study methods were approved by ethics committees of the medical faculty of the University of Münster (ISAAC phase II data center) and the ethics committee of the Bavarian medical council (center for genetic analysis).

       Genotyping

      Genomic DNA was extracted from whole blood by a standard salting out method.
      • Miller S.A.
      • Dykes D.D.
      • Polesky H.F.
      A simple salting out procedure for extracting DNA from human nucleated cells.
      To increase DNA yield, random DNA preamplification with GenomiPhi (Amersham Biosciences, Freiberg, Germany) was performed. DNA samples were genotyped for R501X, 2282del4, and 3702delG using matrix-assisted laser desorption/ionization time-of flight mass spectrometry (www.sequenom.com). PCR assays and associated extension reactions were designed using the SpectroDESIGNER software (Sequenom, San Diego, Calif). All amplification and extension reaction conditions have been previously described.
      • Weidinger S.
      • Illig T.
      • Baurecht H.
      • Irvine A.D.
      • Rodriguez E.
      • Diaz-Lacava A.
      • et al.
      Loss-of-function variations within the filaggrin gene predispose for atopic dermatitis with allergic sensitizations.
      Primer extension products were analyzed by a MassARRAY mass spectrometer (Sequenom; www.bdal.de), and resulting mass spectra were analyzed using the SpectroTYPER RT 2.0 software (Sequenom). Primers for genotyping were ACGTTGGATGCTGGAGGAAGACAAGGATCG, ACGTTGGATGATGGTGTCCTGA CCCTCTTG, and ATGCCTGGAGCTGTCTC (extension primer) for R501X; ACGTTGGATGTCTTGGTGGCTCTGCTGATG, ACGTTGGATGGGGACATTCAGAA GACTCAG, and GACTCAGACACACAGT (extension primer) for 2282del4; and ACGTTGGATGTGTGAGTGTCTAGAGCTGTC, ACGTTGGATGACAAACAATC AGG AGACGGC, and GCTCCAGGCACTCAGGT (extension primer) for the 3702delG variant. Genotyping of R2447X and S3247X was performed by using the TaqMan allelic discrimination method (Applied Biosystems, Foster City, Calif), and the 3702delG genotyping was repeated using this method as also reported by Sandilands et al.
      • Sandilands A.
      • Terron-Kwiatkowski A.
      • Hull P.R.
      • O'Regan G.M.
      • Clayton T.H.
      • Watson R.M.
      • et al.
      Comprehensive analysis of the gene encoding filaggrin uncovers prevalent and rare mutations in ichthyosis vulgaris and atopic eczema.
      To control for errors and technical problems in genotyping, derived genotype frequencies were compared with the expected allelic population equilibrium based on the Hardy-Weinberg equilibrium (HWE) test.

       Histology

      Normal nasal tissue in 4-μm sections was obtained at excision of an unrelated dermal-based mesenchymal lesion from an otherwise healthy patient. Multiple sections for immunostaining were taken at regular intervals along a continuum from the free alar margin through transitional epithelium and nasal respiratory epithelium. Immunohistochemical staining was performed by using the Biogenesis antifilaggrin antibody (Biogenesis, Poole, UK) (catalog no. 4480-0905) after automated antigen retrieval by heat on the Benchmark automated stainer (Ventana Medical Systems, Tucson, Ariz).

       Statistical analysis

      Descriptive statistics for quantitative values are given as means (±SDs) and for qualitative values by absolute and relative frequencies. To test the fit of genotype frequencies with the HWE, a χ2 goodness-of-fit test was used, implemented in PROC ALLELE (SAS statistical software package 9.1; SAS Institute, Cary, NC). Association of binary traits with genetic variations and thus estimation of the odds ratios (ORs) with 95% CIs was evaluated by logistic regression models using SAS 9.1. Models were adjusted for sex, and best parameter sets to fit the model were found by using backward selection methods. In a secondary approach, based on the known genetic effect of FLG mutations, eczema was specified as an additional covariate to evaluate genetic effects on binary traits independently of eczema. Values for total serum IgE levels were first log-transformed, and linear regression models were applied. Skin test results were analyzed by using logistic models. The population attributable risk (PAR) was calculated as follows: PAR = [PrevE (OR-1)]/[1+PrevE (OR-1)], where PrevE is the prevalence of exposure (proportion of FLG mutation carriers in the population) and OR is the estimated OR from multiple regression models.
      • Hennekens C.
      • Buring J.
      Measures of disease frequency and association.

      Results

      The clinical characteristics of the study population are outlined in Table I. For the current study, 5 FLG mutations previously identified to result in a deficiency of filaggrin expression were genotyped in 3099 German children. The genotyping success rate was 97.3% for 2282del4, 98.9% for R501X, 97.7%% for R2447X, 96.7% for S3247X, and 97.0% for 3702delG. Carriers of 3702delG could be identified with neither matrix-assisted laser desorption/ionization time-of flight nor TaqMan genotyping in our population. Observed genotype frequencies did not deviate significantly from expected frequencies under the HWE assumption.
      Table IDescriptive characterization of the ISAAC II study population comparing genotyped individuals included in this analysis (N = 3099)
      No.
      Number affected/number with data available.
      Percent
      Male sex1561/309950.4
      Age (y), mean (SD)9.6 (0.6)
      Eczema540/299418.0
      Atopic eczema193/29016.7
      Asthma272/30548.9
      Atopic asthma124/29064.3
      Allergic rhinitis214/29387.3
      Sensitization777/300225.9
      Current wheeze256/30528.4
      Currently visible eczema169/30985.5
      Current allergic rhinitis symptoms441/303714.5
      Number affected/number with data available.
      In this cross-sectional German population, the 2282del4 variant was present in 4.6% of children, and the frequency of carriers of R501X was 1.9%, with 0.1% of children carrying both mutations concomitantly, resulting in a combined carrier frequency of 6.4%. R2447X was present in 0.7% and S3247X in 0.2% of children. The combined carrier frequency of R501X, 2282del4, R2447X, and S3247X was 7.4% (Table II, Table III).
      Table IIFrequency of FLG null alleles R501X, 2282del4, R2447X, and S3247X
      No carriers of 3702G observed.
      in children affected by eczema or allergic rhinitis and unaffected children
      Unaffected children are defined as individuals without the investigated trait.
      Percentages are given with respect to 3099 children included in the study. Individuals with missing genotype or phenotype information are not explicitly shown in the table.
      R501x2282del4R2447XS3247X
      EczemaAllergic rhinitisEczemaAllergic rhinitisEczemaAllergic rhinitisEczemaAllergic rhinitis
      AffectedUnaffectedAffectedUnaffectedAffectedUnaffectedAffectedUnaffectedAffectedUnaffectedAffectedUnaffectedAffectedUnaffectedAffectedUnaffected
      AA511 (94.6%)2395 (97.6%)200 (93.5%)2650 (97.3%)479 (88.7%)2294 (93.5%)190 (88.8%)2537 (93.1%)519 (96.1%)2386 (97.2%)207 (96.7%)2645 (97.1%)525 (97.2%)2362 (96.3%)207 (96.7%)2627 (96.4%)
      Aa25 (4.6%)32 (1.3%)11 (5.1%)48 (1.8%)52 (9.6%)86 (3.5%)21 (9.8%)31 (4.0%)10 (1.9%)10 (0.4%)1 (0.5%)19 (0.7%)6 (0.2%)5 (0.2%)
      Aa1 (0.04%)1 (0.004%)1 (0.04%)
      For combined genotypes of R501X, 2282del4, R2447X, and S3247X variants, the minor allele label a refers to the dominant mutant alleles.
      No carriers of 3702G observed.
      Unaffected children are defined as individuals without the investigated trait.
      Percentages are given with respect to 3099 children included in the study. Individuals with missing genotype or phenotype information are not explicitly shown in the table.
      Table IIIFrequency of combined common FLG null alleles in children affected by eczema or allergic rhinitis and unaffected children
      Unaffected children are defined as individuals without the investigated trait.
      Percentages are given with respect to 3099 children included in the study. Individuals with missing genotype or phenotype information are not explicitly shown in the table.
      Combined genotype (R501X, 2282del4, R2447X, S3247X)
      EczemaAllergic rhinitis
      AffectedUnaffectedAffectedUnaffected
      AA437 (80.9%)2206 (89.9%)175 (81.8%)2420 (88.8%)
      Aa83 (15.4%)134 (5.5%)33 (15.4%)178 (6.5%)
      aa2 (0.4%)2 (0.08%)4 (0.2%)
      For combined genotypes of R501X, 2282del4, R2447X, and S3247X variants, the minor allele label a refers to the dominant mutant alleles.
      Unaffected children are defined as individuals without the investigated trait.
      Percentages are given with respect to 3099 children included in the study. Individuals with missing genotype or phenotype information are not explicitly shown in the table.
      Table IV summarizes the results of association analysis. FLG variants were strongly overrepresented in eczema cases (OR, 3.12; 95% CI, 2.33-4.17; P = 2.5 × 10−14) for combined genotype). In addition, in the total population we observed a significantly increased risk of rhinitis (OR, 2.32; 95% CI, 1.59-3.36; P = 1.0 × 10−5) and asthma (OR, 1.79; 95% CI, 1.19-2.68; P = .0048). Associations became even stronger when restricting the analysis to the allergic subphenotypes atopic eczema (OR, 4.57; 95% CI, 3.08-6.74; P = 3.2 × 10−14) and allergic rhinitis (OR, 2.64; 95% CI, 1.76-3.96; P = 2.5 × 10−6). Independent analysis of the Munich (n = 1159) and Dresden (n = 1940) populations showed associations with rhinitis and allergic rhinitis in both cohorts (see this article's Table E1 in the Online Repository at www.jacionline.org). Accordingly, FLG alleles conferred an increased risk for sensitization as measured by skin test (OR, 1.61; 95% CI, 1.20-2.17; P = .0017), which was strongest in individuals with eczema (OR, 2.04; 95% CI, 1.25-3.33; P = .0043). Similar trends were observed for specific serum IgE levels (data not shown). The association with atopic asthma per se was only borderline significant (OR, 1.78; 95% CI, 0.99-3.18; P = .0524), whereas the complex asthma plus eczema phenotype was strongly associated (OR, 3.49; 95% CI, 2.00-6.08; P = 1.0 × 10−5). After adjusting for eczema or atopic eczema, associations with asthma and atopic asthma still showed a positive trend, but the association was now no longer significant. In contrast, the association with allergic rhinitis (OR, 2.25; 95% CI, 1.48-3.41; P = 1.0 × 10−4; and OR, 1.93; 95% CI, 1.21-3.05; P = .0053) remained significant (Table IV). Also, an analysis stratified for eczema showed associations with rhinitis but not with asthma (Table V). However, the association with current allergic rhinitis symptoms was clearly weaker after adjustment for eczema (OR, 1.40; 95% CI, 0.99–2.00; P = .061). Additional analyses of subphenotypes showed strong associations of asthma plus rhinitis (OR, 2.63; 95% CI, 1.21-5.70) and rhinitis but no asthma (OR, 2.54; 95% CI, 1.62-4.00), whereas the association of asthma but no rhinitis was only borderline significant (OR, 1.53; 95% CI, 0.941-2.495).
      Table IVORs and 95% CIs for associations between FLG mutations and selected atopic phenotypes based on a logistic regression models adjusted for sex by using backward variable selection (OR calculated for heterozygote vs wild-type)
      Combined genotype (R501X, 2282del4, R2447X, S3247X)
      PhenotypeOR95% CIP value
      Eczema3.1152.3264.1732.5 × 10−14
      Atopic eczema4.5563.0806.7403.2 × 10−14
      Currently visible eczema2.9811.9544.5484.0 × 10−7
      Asthma1.7901.1942.684.0048
      Atopic asthma1.7770.9943.175.0524
      Current wheeze1.7521.1562.655.0082
      Allergic rhinitis2.6401.7623.9552.5 × 10−6
      Current allergic rhinitis symptoms1.6861.2002.371.0026
      Sensitization (skin test reactivity)1.6091.1952.167.0017
      Sensitization adjusted for eczema1.4601.0731.986.0160
      Allergic rhinitis adjusted for eczema2.2451.4803.406.0001
      Allergic rhinitis adjusted for atopic eczema1.9251.2143.053.0053
      Asthma adjusted for eczema1.5150.9992.299NS
      Asthma adjusted for atopic eczema1.3750.8512.222NS
      Atopic asthma adjusted for eczema1.3790.7572.514NS
      Atopic asthma adjusted for atopic eczema1.1110.5862.107NS
      Table VAssociation of FLG mutations with selected atopic phenotypes in the presence and absence of eczema
      Allergic rhinitisAsthmaAtopic asthma
      OR95% CIP valueOR95% CIP valueOR95% CIP value
      Eczema (n = 540)2.0011.0783.176.02801.5180.8312.773NS1.6460.7663.539NS
      No eczema (n = 2454)2.4711.4154.316.00151.5250.8552.721NS1.0460.3742.927NS
      Immunohistochemical staining of skin in multiple, serially taken sections in the nasal vestibule up to the transitional epithelium consistently showed a typical granular pattern of filaggrin staining in the granular layer and a more diffuse pattern in the stratum corneum, consistent with normally differentiated hair-bearing skin. No filaggrin expression was seen in the transitional mucosa or respiratory mucosa (Fig 1).
      Figure thumbnail gr1
      Fig 1Nasal filaggrin expression. Sections of vestibular skin (A), transitional epithelium (B), and respiratory mucosa (C). In the vestibular skin, staining is identical to the pattern observed in normal hair-bearing skin with strong granular staining in the granular layer and more diffuse staining of the stratum corneum. In transitional and respiratory nasal epithelia, no typical filaggrin staining is demonstrable. There is minimal edge artefact that is not significant. All original magnifications ×100.
      For eczema, the penetrance of FLG null alleles was 38.5%, and the PAR, which indicates the proportion of eczema cases in the population attributable to the mutant FLG alleles, was 13.5% on the basis of the observed carrier frequency of mutant FLG alleles of 7.4% in the population. For allergic rhinitis, the PAR was 10.8%, and 8.4% when adjusted for eczema, whereas the PAR for allergic rhinitis in combination with eczema was as high as 20.1% and for asthma in combination with eczema was 15.6% (Table VI).
      Table VIPAR estimates and 95% CIs and penetrance (with exact P value) caused by FLG mutations R501X, 2282del4, R2447X, and S3247X (based on the observed carrier frequency for the combined genotype of 7.4%)
      PAR95% CIPenetrance
      Eczema13.5%8.9%19.0%38.5% (1.3 × 10−13)
      Allergic rhinitis10.8%5.3%17.9%15.4% (3.1 × 10−5)
      Eczema + allergic rhinitis20.1%9.9%33.4%8.1% (9.7 × 10−6)
      Eczema + asthma15.6%6.9%27.3%8.3% (3.2 × 10−5)

      Discussion

      This is a large-scale population-based study dissecting the influence of FLG mutations on eczema and a range of atopic diseases such as asthma and allergic rhinitis in the general population. In addition to exceptionally strong and consistent effects of FLG mutations on eczema and atopic eczema, associations with allergic sensitization and allergic rhinitis, independently of eczema, were demonstrated. In contrast, and in line with previous studies,
      • Palmer C.N.
      • Irvine A.D.
      • Terron-Kwiatkowski A.
      • Zhao Y.
      • Liao H.
      • Lee S.P.
      • et al.
      Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis.
      • Marenholz I.
      • Nickel R.
      • Ruschendorf F.
      • Schulz F.
      • Esparza-Gordillo J.
      • Kerscher T.
      • et al.
      Filaggrin loss-of-function mutations predispose to phenotypes involved in the atopic march.
      • Rogers A.J.
      • Celedon J.C.
      • Lasky-Su J.A.
      • Weiss S.T.
      • Raby B.A.
      Filaggrin mutations confer susceptibility to atopic dermatitis but not to asthma.
      an association with asthma was noted, but there was no direct effect of FLG mutations on asthma or atopic asthma in the absence of eczema. However, as also observed in the large longitudinal population-based Avon Longitudinal Study of Parents and Children, there was a strong association with the complex asthma plus eczema phenotype with an OR of 3.49 in ISAAC II (OR for asthma plus eczema, 3.42 in ALSPAC).
      • Henderson J.
      • Northstone K.
      • Lee S.P.
      • Liao H.
      • Zhao Y.
      • Pembrey M.
      • et al.
      The burden of disease associated with filaggrin mutations: a population based, longitudinal birth cohort study.
      On the basis of these results, FLG must be considered to be a major gene in the development of eczema, atopic sensitization, and allergic rhinitis, with a significant effect in asthma that is restricted to patients with a history of eczema.
      Filaggrin is a key protein in the formation of the outermost keratin layer of the skin,
      • Candi E.
      • Schmidt R.
      • Melino G.
      The cornified envelope: a model of cell death in the skin.
      with additional properties contributing to the hydration of the stratum corneum.
      • Presland R.B.
      • Boggess D.
      • Lewis S.P.
      • Hull C.
      • Fleckman P.
      • Sundberg J.P.
      Loss of normal profilaggrin and filaggrin in flaky tail (ft/ft) mice: an animal model for the filaggrin-deficient skin disease ichthyosis vulgaris.
      Thus, a genetically determined filaggrin deficiency was first considered and confirmed to be involved in ichthyosis vulgaris, a common disease leading to an excessive scaling of the skin, and in eczema.
      • Smith F.J.
      • Irvine A.D.
      • Terron-Kwiatkowski A.
      • Sandilands A.
      • Campbell L.E.
      • Zhao Y.
      • et al.
      Loss-of-function mutations in the gene encoding filaggrin cause ichthyosis vulgaris.
      Concerning clinically manifest eczema, FLG-null alleles show an incomplete penetrance of 38.5%. Recently we demonstrated a strong association of FLG mutations with dry skin as an intermediate trait.
      • Novak N.
      • Baurecht H.
      • Schafer T.
      • Rodriguez E.
      • Wagenpfeil S.
      • Klopp N.
      • et al.
      Loss-of function mutations in the filaggrin gene and allergic contact sensitization to nickel.
      Thus, it seems plausible that FLG mutations primarily cause a dry or defective skin barrier which, when driven by additional genetic and environmental factors, results in eczema in a large proportion of carriers.
      Independently from eczema, FLG mutations showed a significant association with allergic sensitization and allergic rhinitis in our population. The association with allergic rhinitis was also independent from the presence (OR, 2.63; 95% CI, 1.21-5.70) or absence (OR, 2.54; 95% CI, 1.62-4.00) of concomitant asthma, and could be observed in both subpopulations when analyzed independently (data not shown). In contrast, the contribution of FLG mutations to the complex etiology of asthma per se seems to be limited to those with previous eczema.
      Our results support recent epidemiologic data indicating an early comanifestation of atopic eczema and asthma rather than a progressive atopic march
      • Illi S.
      • von Mutius E.
      • Lau S.
      • Nickel R.
      • Gruber C.
      • Niggemann B.
      • et al.
      The natural course of atopic dermatitis from birth to age 7 years and the association with asthma.
      and a stronger overlap between eczema and allergic rhinitis.
      • Strachan D.P.
      Parallels with the epidemiology of other allergic diseases.
      • Thomsen S.F.
      • Ulrik C.S.
      • Kyvik K.O.
      • Skadhauge L.R.
      • Steffensen I.
      • Backer V.
      Findings on the atopic triad from a Danish twin registry.
      However, in contrast with allergic rhinitis, the observed risk for the trait current allergic rhinitis symptoms (reflecting the 12-month period prevalence of symptoms before recruitment) was only borderline significant after adjustment for eczema. This observation is in line with findings from the ALSPAC cohort, in which, in contrast with our study, FLG associations with allergic rhinitis were limited to those with previous eczema.
      • Henderson J.
      • Northstone K.
      • Lee S.P.
      • Liao H.
      • Zhao Y.
      • Pembrey M.
      • et al.
      The burden of disease associated with filaggrin mutations: a population based, longitudinal birth cohort study.
      In this context, it has to be considered that our study is a cross-sectional study that documents the precise and detailed phenotypes present in the study population at the time point when they are examined (in this case, 9-11 years of age) and records details of previous illnesses (physician-diagnosed eczema ever) as recalled by the parents at the time of interview. Thus, there is a possibility of recall bias against previous eczema, and it cannot be ruled out that the effect of filaggrin mutations on allergic rhinitis observed here in 2 independent populations was entirely independent of previous eczema and that FLG mutations exert an effect on rhinitis as a result of previous eczema, however mild. Carefully phenotyped studies will be needed to clarify these open questions.
      Filaggrin is expressed in other keratinizing epithelia—for example, in the oral cavity
      • Presland R.B.
      • Dale B.A.
      Epithelial structural proteins of the skin and oral cavity: function in health and disease.
      and the ocular conjunctiva.
      • Krenzer K.L.
      • Freddo T.F.
      Cytokeratin expression in normal human bulbar conjunctiva obtained by impression cytology.
      So far, filaggrin has not been detected in the human bronchial epithelium.
      • De Benedetto A.
      • Qualia C.M.
      • Baroody F.M.
      • Beck L.A.
      Filaggrin expression in oral, nasal, and esophageal mucosa.
      • Ying S.
      • Meng Q.
      • Corrigan C.J.
      • Lee T.H.
      Lack of filaggrin expression in the human bronchial mucosa.
      Here, we demonstrate that filaggrin is expressed in the anterior vestibulum of the nose, but not in transitional and respiratory nasal epithelia. Thus, it seems unlikely that FLG mutations exert organ-specific and local effects in the upper airways. Indeed, the mechanisms through which FLG mutations contribute to airway disease are not understood yet. Percutaneous priming
      • Hudson T.J.
      Skin barrier function and allergic risk.
      and secondary immunologic effects from the induction of TH2 cytokines in epithelia
      • Howell M.D.
      • Kim B.E.
      • Gao P.
      • Grant A.V.
      • Boguniewicz M.
      • Debenedetto A.
      • et al.
      Cytokine modulation of atopic dermatitis filaggrin skin expression.
      are interesting hypotheses that have been put forward, but need further investigation.
      FLG mutations are strongly overrepresented in children with atopic eczema or allergic rhinitis as indicated in Table II, Table III. Because of the low frequencies of minor alleles of 2.40% for 2282del4 and 0.96% for R501X, individuals homozygote for the mutations are rarely found, even after genotyping 3099 individuals. Interestingly, 2 out of 3 individuals carrying 2 mutations have eczema, whereas none of them seems to be affected by rhinitis at the age of 9 to 11 years, when the survey was conducted, demonstrating that genotype-phenotype correlation is not completely linear and the penetrance of the FLG effect is incomplete. Although these preliminary results are intriguing, caution should be used when drawing conclusions based on the very small numbers of homozygotes seen here.
      However, with the estimated penetrance of 38.5% and a PAR of 13.5% for eczema and 10.8% for allergic rhinitis as well as 20.1% and 15.6% for the complex phenotypes eczema plus rhinitis and eczema plus asthma, respectively, the effect of these single gene variants is extremely strong. The PAR for eczema plus asthma is very consistent with the ALSPAC cohort, which estimated this to be 15.6%.
      • Henderson J.
      • Northstone K.
      • Lee S.P.
      • Liao H.
      • Zhao Y.
      • Pembrey M.
      • et al.
      The burden of disease associated with filaggrin mutations: a population based, longitudinal birth cohort study.
      Although previously only rough estimates of PAR based on the 2 most common variants existed,
      • Marenholz I.
      • Nickel R.
      • Ruschendorf F.
      • Schulz F.
      • Esparza-Gordillo J.
      • Kerscher T.
      • et al.
      Filaggrin loss-of-function mutations predispose to phenotypes involved in the atopic march.
      this is the first assessment of the PAR truly based on data from the general population and including less frequent variants. Interestingly, both the originally identified null mutations (R501X and 2282del4) and the less common variants R2447X, S3247X, and 3702delG appear to be significantly more prevalent in United Kingdom and Irish populations (compared with continental Europe),
      • Smith F.J.
      • Irvine A.D.
      • Terron-Kwiatkowski A.
      • Sandilands A.
      • Campbell L.E.
      • Zhao Y.
      • et al.
      Loss-of-function mutations in the gene encoding filaggrin cause ichthyosis vulgaris.
      • Sandilands A.
      • Terron-Kwiatkowski A.
      • Hull P.R.
      • O'Regan G.M.
      • Clayton T.H.
      • Watson R.M.
      • et al.
      Comprehensive analysis of the gene encoding filaggrin uncovers prevalent and rare mutations in ichthyosis vulgaris and atopic eczema.
      • Barker J.N.
      • Palmer C.N.
      • Zhao Y.
      • Liao H.
      • Hull P.R.
      • Lee S.P.
      • et al.
      Null mutations in the filaggrin gene (FLG) determine major susceptibility to early-onset atopic dermatitis that persists into adulthood.
      which might reflect ethnic differences. Furthermore, the genetic architecture of FLG-related eczema mutations seems to consist of a mixture of prevalent FLG mutations common to different populations and several infrequent, family-specific, and private mutations.
      • Sandilands A.
      • Smith F.J.
      • Irvine A.D.
      • McLean W.H.
      Filaggrin's fuller figure: a glimpse into the genetic architecture of atopic dermatitis.
      The FLG gene is located within the epidermal differentiation complex (EDC) on chromosome 1q21. The EDC is a dense cluster of genes involved in the terminal differentiation of the epidermis and formation of the stratum corneum.
      • Mischke D.
      • Korge B.P.
      • Marenholz I.
      • Volz A.
      • Ziegler A.
      Genes encoding structural proteins of epidermal cornification and S100 calcium-binding proteins form a gene complex (“epidermal differentiation complex”) on human chromosome 1q21.
      Because the EDC comprises further genes and gene families important for the differentiation of the human epidermis, it is conceivable that additional genetic variants in other genes of the EDC may additionally contribute to the risk to develop eczema.
      • Cookson W.O.
      • Ubhi B.
      • Lawrence R.
      • Abecasis G.R.
      • Walley A.J.
      • Cox H.E.
      • et al.
      Genetic linkage of childhood atopic dermatitis to psoriasis susceptibility loci.
      Whether any of these genes may also be involved in the development of airway disease remains to be seen.
      Our results may help us understand better the genetic susceptibility of complex diseases. The strong impact of FLG mutations with a rather low frequency on eczema and allergic rhinitis challenges the common disease-common variants hypothesis suggesting that such common diseases as asthma, eczema, and rhinitis are predominantly caused by mutations highly frequent in the population.
      • Pritchard J.K.
      • Cox N.J.
      The allelic architecture of human disease genes: common disease-common variant...or not?.
      • Cohen J.C.
      • Kiss R.S.
      • Pertsemlidis A.
      • Marcel Y.L.
      • McPherson R.
      • Hobbs H.H.
      Multiple rare alleles contribute to low plasma levels of HDL cholesterol.
      The fact that infrequent mutations may be associated with common diseases needs consideration, because a new generation of genome-wide association studies is emerging, predominantly based on frequent haplotype-tagging polymorphisms. Using these approaches, FLG effects would have been missed.
      In addition, the “1 airway, 1 disease” hypothesis suggesting that the nose and the lung share the same mucosa and that therefore the same mechanisms lead to the development of rhinitis and asthma, might be an oversimplification.
      • Grossman J.
      One airway, one disease.
      • Bousquet J.
      • Jacot W.
      • Vignola A.M.
      • Bachert C.
      • Van Cauwenberge P.
      Allergic rhinitis: a disease remodeling the upper airways?.
      Now that FLG mutations have been established as a major cause of atopic eczema, their newly discovered role in the development of allergic rhinitis needs to be further elucidated, including replication of associations and systematic expression studies in the upper and lower airways. Additional large-scale and longitudinal studies will be needed to give definite answers about how FLG mutations may affect the development of asthma. Furthermore, ethnic differences in allele frequencies across Europe and the world need to be studied.
      Assessing the effects of FLG deficiency has been the first step toward the understanding of a major disease mechanism in the development of eczema, asthma, and allergic rhinitis. Reconstitution of filaggrin function or compensation of filaggrin deficiency may be next steps building the groundwork for new strategies in prevention and treatment of these common diseases.
      Clinical implications
      FLG mutations predispose to eczema and are also risk factors for allergic sensitization and allergic rhinitis. Patients with filaggrin-related eczema are at increased risk of developing asthma.
      We thank Stefan Wagenpfeil and Martina Müller for statistical support. Filaggrin research in the McLean laboratory is supported by grants from the British Skin Foundation, the National Eczema Society, the Medical Research Council (reference no. G0700314), and donations from anonymous families affected by eczema in the Tayside region of Scotland.

      Table E1.

      Tabled 1Association of filaggrin mutations with allergic rhinitis in ISAAC II
      Combined genotype (R501X, 2282del4, R2447X, S3247X)
      PhenotypeOR95% CIP value
      Physician-diagnosed allergic rhinitis (Munich and Dresden combined)2.3201.5983.3681.0 × 10
      Physician-diagnosed allergic rhinitis Munich3.6032.0126.4531.6 × 10−5
      Physician-diagnosed allergic rhinitis Dresden1.7651.0792.888.0238
      Allergic rhinitis (physician's diagnosis and SPT reaction to inhalant allergen)2.6401.7623.9552.5 × 10−6
      Allergic rhinitis Munich4.0652.1997.5147.7 × 10−6
      Allergic rhinitis Dresden1.9751.1453.407.0144
      Current allergic rhinitis symptoms (last 12 mo)1.6861.2002.371.0026
      Current allergic rhinitis symptoms Munich1.8501.0943.128.0217
      Current allergic rhinitis symptoms Dresden1.5711.0022.463.0491
      Combined and independent analyses of filaggrin associations with physician-diagnosed allergic rhinitis, without/in combination with allergic sensitization to inhalant allergens and symptoms of allergic rhinitis within the last 12 months (current symptoms) in the Munich (n = 1159) and Dresden (n = 1940) samples.

      References

        • Smith F.J.
        • Irvine A.D.
        • Terron-Kwiatkowski A.
        • Sandilands A.
        • Campbell L.E.
        • Zhao Y.
        • et al.
        Loss-of-function mutations in the gene encoding filaggrin cause ichthyosis vulgaris.
        Nat Genet. 2006; 38: 337-342
        • Palmer C.N.
        • Irvine A.D.
        • Terron-Kwiatkowski A.
        • Zhao Y.
        • Liao H.
        • Lee S.P.
        • et al.
        Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis.
        Nat Genet. 2006; 38: 441-446
        • Sandilands A.
        • Terron-Kwiatkowski A.
        • Hull P.R.
        • O'Regan G.M.
        • Clayton T.H.
        • Watson R.M.
        • et al.
        Comprehensive analysis of the gene encoding filaggrin uncovers prevalent and rare mutations in ichthyosis vulgaris and atopic eczema.
        Nat Genet. 2007; 39: 650-654
        • Irvine A.D.
        • McLean W.H.
        Breaking the (un)sound barrier: filaggrin is a major gene for atopic dermatitis.
        J Invest Dermatol. 2006; 126: 1200-1202
        • Baurecht H.
        • Irvine A.D.
        • Novak N.
        • Illig T.
        • Buhler B.
        • Ring J.
        • et al.
        Toward a major risk factor for atopic eczema: meta-analysis of filaggrin polymorphism data.
        J Allergy Clin Immunol. 2007; 120: 1406-1412
        • Krenzer K.L.
        • Freddo T.F.
        Cytokeratin expression in normal human bulbar conjunctiva obtained by impression cytology.
        Invest Ophthalmol Vis Sci. 1997; 38: 142-152
        • Presland R.B.
        • Dale B.A.
        Epithelial structural proteins of the skin and oral cavity: function in health and disease.
        Crit Rev Oral Biol Med. 2000; 11: 383-408
        • De Benedetto A.
        • Qualia C.M.
        • Baroody F.M.
        • Beck L.A.
        Filaggrin expression in oral, nasal, and esophageal mucosa.
        J Invest Dermatol. 2008; (Jan 3 [epub ahead of print])
        • Johansson S.G.
        • Bieber T.
        • Dahl R.
        • Friedmann P.S.
        • Lanier B.Q.
        • Lockey R.F.
        • et al.
        Revised nomenclature for allergy for global use: report of the Nomenclature Review Committee of the World Allergy Organization, October 2003.
        J Allergy Clin Immunol. 2004; 113: 832-836
        • Weiland S.K.
        • von Mutius E.
        • Hirsch T.
        • Duhme H.
        • Fritzsch C.
        • Werner B.
        • et al.
        Prevalence of respiratory and atopic disorders among children in the East and West of Germany five years after unification.
        Eur Respir J. 1999; 14: 862-870
        • Jenkins M.A.
        • Clarke J.R.
        • Carlin J.B.
        • Robertson C.F.
        • Hopper J.L.
        • Dalton M.F.
        • et al.
        Validation of questionnaire and bronchial hyperresponsiveness against respiratory physician assessment in the diagnosis of asthma.
        Int J Epidemiol. 1996; 25: 609-616
        • Williams H.C.
        • Burney P.G.
        • Pembroke A.C.
        • Hay R.J.
        Validation of the U.K. diagnostic criteria for atopic dermatitis in a population setting. U.K. Diagnostic Criteria for Atopic Dermatitis Working Party.
        Br J Dermatol. 1996; 135: 12-17
        • Braun-Fahrlander C.
        • Wuthrich B.
        • Gassner M.
        • Grize L.
        • Sennhauser F.H.
        • Varonier H.S.
        • et al.
        Validation of a rhinitis symptom questionnaire (ISAAC core questions) in a population of Swiss school children visiting the school health services. SCARPOL-team. Swiss Study on Childhood Allergy and Respiratory Symptom with respect to Air Pollution and Climate. International Study of Asthma and Allergies in Childhood.
        Pediatr Allergy Immunol. 1997; 8: 75-82
        • Williams H.C.
        • Forsdyke H.
        • Boodoo G.
        • Hay R.J.
        • Burney P.G.
        A protocol for recording the sign of flexural dermatitis in children.
        Br J Dermatol. 1995; 133: 941-949
        • Miller S.A.
        • Dykes D.D.
        • Polesky H.F.
        A simple salting out procedure for extracting DNA from human nucleated cells.
        Nucleic Acids Res. 1988; 16: 1215
        • Weidinger S.
        • Illig T.
        • Baurecht H.
        • Irvine A.D.
        • Rodriguez E.
        • Diaz-Lacava A.
        • et al.
        Loss-of-function variations within the filaggrin gene predispose for atopic dermatitis with allergic sensitizations.
        J Allergy Clin Immunol. 2006; 118: 214-219
        • Hennekens C.
        • Buring J.
        Measures of disease frequency and association.
        in: Hennekens C.H. Buring J.E. Epidemiology in medicine. Little, Brown and Co, Boston (MA)1987: 90-93
        • Marenholz I.
        • Nickel R.
        • Ruschendorf F.
        • Schulz F.
        • Esparza-Gordillo J.
        • Kerscher T.
        • et al.
        Filaggrin loss-of-function mutations predispose to phenotypes involved in the atopic march.
        J Allergy Clin Immunol. 2006; 118: 866-871
        • Rogers A.J.
        • Celedon J.C.
        • Lasky-Su J.A.
        • Weiss S.T.
        • Raby B.A.
        Filaggrin mutations confer susceptibility to atopic dermatitis but not to asthma.
        J Allergy Clin Immunol. 2007; 120: 1332-1337
        • Henderson J.
        • Northstone K.
        • Lee S.P.
        • Liao H.
        • Zhao Y.
        • Pembrey M.
        • et al.
        The burden of disease associated with filaggrin mutations: a population based, longitudinal birth cohort study.
        J Allergy Clin Immunol. 2008; (Mar 4 [epub ahead of print])
        • Candi E.
        • Schmidt R.
        • Melino G.
        The cornified envelope: a model of cell death in the skin.
        Nat Rev Mol Cell Biol. 2005; 6: 328-340
        • Presland R.B.
        • Boggess D.
        • Lewis S.P.
        • Hull C.
        • Fleckman P.
        • Sundberg J.P.
        Loss of normal profilaggrin and filaggrin in flaky tail (ft/ft) mice: an animal model for the filaggrin-deficient skin disease ichthyosis vulgaris.
        J Invest Dermatol. 2000; 115: 1072-1081
        • Novak N.
        • Baurecht H.
        • Schafer T.
        • Rodriguez E.
        • Wagenpfeil S.
        • Klopp N.
        • et al.
        Loss-of function mutations in the filaggrin gene and allergic contact sensitization to nickel.
        J Invest Dermatol. 2007; (Nov 29 [epub ahead of print])
        • Illi S.
        • von Mutius E.
        • Lau S.
        • Nickel R.
        • Gruber C.
        • Niggemann B.
        • et al.
        The natural course of atopic dermatitis from birth to age 7 years and the association with asthma.
        J Allergy Clin Immunol. 2004; 113: 925-931
        • Strachan D.P.
        Parallels with the epidemiology of other allergic diseases.
        in: Williams H.C. Atopic dermatitis: the epidemiology, causes and prevention of atopic eczema. Cambridge University Press, Cambridge2000: 221-232
        • Thomsen S.F.
        • Ulrik C.S.
        • Kyvik K.O.
        • Skadhauge L.R.
        • Steffensen I.
        • Backer V.
        Findings on the atopic triad from a Danish twin registry.
        Int J Tuberc Lung Dis. 2006; 10: 1268-1272
        • Ying S.
        • Meng Q.
        • Corrigan C.J.
        • Lee T.H.
        Lack of filaggrin expression in the human bronchial mucosa.
        J Allergy Clin Immunol. 2006; 118: 1386-1388
        • Hudson T.J.
        Skin barrier function and allergic risk.
        Nat Genet. 2006; 38: 399-400
        • Howell M.D.
        • Kim B.E.
        • Gao P.
        • Grant A.V.
        • Boguniewicz M.
        • Debenedetto A.
        • et al.
        Cytokine modulation of atopic dermatitis filaggrin skin expression.
        J Allergy Clin Immunol. 2007; 120: 150-155
        • Barker J.N.
        • Palmer C.N.
        • Zhao Y.
        • Liao H.
        • Hull P.R.
        • Lee S.P.
        • et al.
        Null mutations in the filaggrin gene (FLG) determine major susceptibility to early-onset atopic dermatitis that persists into adulthood.
        J Invest Dermatol. 2007; 127: 564-567
        • Sandilands A.
        • Smith F.J.
        • Irvine A.D.
        • McLean W.H.
        Filaggrin's fuller figure: a glimpse into the genetic architecture of atopic dermatitis.
        J Invest Dermatol. 2007; 127: 1282-1284
        • Mischke D.
        • Korge B.P.
        • Marenholz I.
        • Volz A.
        • Ziegler A.
        Genes encoding structural proteins of epidermal cornification and S100 calcium-binding proteins form a gene complex (“epidermal differentiation complex”) on human chromosome 1q21.
        J Invest Dermatol. 1996; 106: 989-992
        • Cookson W.O.
        • Ubhi B.
        • Lawrence R.
        • Abecasis G.R.
        • Walley A.J.
        • Cox H.E.
        • et al.
        Genetic linkage of childhood atopic dermatitis to psoriasis susceptibility loci.
        Nat Genet. 2001; 27: 372-373
        • Pritchard J.K.
        • Cox N.J.
        The allelic architecture of human disease genes: common disease-common variant...or not?.
        Hum Mol Genet. 2002; 11: 2417-2423
        • Cohen J.C.
        • Kiss R.S.
        • Pertsemlidis A.
        • Marcel Y.L.
        • McPherson R.
        • Hobbs H.H.
        Multiple rare alleles contribute to low plasma levels of HDL cholesterol.
        Science. 2004; 305: 869-872
        • Grossman J.
        One airway, one disease.
        Chest. 1997; 111: 11S-16S
        • Bousquet J.
        • Jacot W.
        • Vignola A.M.
        • Bachert C.
        • Van Cauwenberge P.
        Allergic rhinitis: a disease remodeling the upper airways?.
        J Allergy Clin Immunol. 2004; 113: 43-49