The Journal of Allergy and Clinical Immunology
Volume 127, Issue 3 , Pages 773-786.e7, March 2011

Tight junction defects in patients with atopic dermatitis

  • Anna De Benedetto, MD

      Affiliations

    • Department of Dermatology, University of Rochester Medical Center, Rochester, NY
  • ,
  • Nicholas M. Rafaels, MS

      Affiliations

    • Lowe Family Genomics Core, Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Md
  • ,
  • Laura Y. McGirt, MD

      Affiliations

    • Department of Dermatology, Johns Hopkins University School of Medicine, Baltimore, Md
  • ,
  • Andrei I. Ivanov, PhD

      Affiliations

    • Department of Medicine, University of Rochester Medical Center, Rochester, NY
  • ,
  • Steve N. Georas, MD

      Affiliations

    • Division of Pulmonary & Critical Care Medicine, University of Rochester Medical Center, Rochester, NY
  • ,
  • Chris Cheadle, PhD

      Affiliations

    • Lowe Family Genomics Core, Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Md
  • ,
  • Alan E. Berger, PhD

      Affiliations

    • Lowe Family Genomics Core, Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Md
  • ,
  • Kunzhong Zhang, PhD

      Affiliations

    • Radiation Oncology, University of Rochester Medical Center, Rochester, NY
  • ,
  • Sadasivan Vidyasagar, MD, PhD

      Affiliations

    • Radiation Oncology, University of Rochester Medical Center, Rochester, NY
  • ,
  • Takeshi Yoshida, PhD

      Affiliations

    • Department of Dermatology, University of Rochester Medical Center, Rochester, NY
  • ,
  • Mark Boguniewicz, MD

      Affiliations

    • Department of Pediatrics, National Jewish Health, Denver, Colo
  • ,
  • Tissa Hata, MD

      Affiliations

    • Division of Dermatology, University of California San Diego, San Diego, Calif
  • ,
  • Lynda C. Schneider, MD

      Affiliations

    • Division of Immunology, Children's Hospital Boston, Boston, Mass
  • ,
  • Jon M. Hanifin, MD

      Affiliations

    • Department of Dermatology, Oregon Health & Science University, Portland, Ore
  • ,
  • Richard L. Gallo, MD

      Affiliations

    • Division of Dermatology, University of California San Diego, San Diego, Calif
  • ,
  • Natalija Novak, MD

      Affiliations

    • Department of Dermatology and Allergy, University of Bonn, Bonn, Germany
  • ,
  • Stephan Weidinger, MD

      Affiliations

    • Department of Dermatology and Allergy, Technische Universität München, Munich, Germany
  • ,
  • Terri H. Beaty, PhD

      Affiliations

    • Department of Epidemiology, Johns Hopkins Bloomberg School of Public Health, Baltimore, Md
  • ,
  • Donald Y.M. Leung, MD, PhD

      Affiliations

    • Department of Pediatrics, National Jewish Health, Denver, Colo
  • ,
  • Kathleen C. Barnes, PhD

      Affiliations

    • Lowe Family Genomics Core, Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Md
  • ,
  • Lisa A. Beck, MD

      Affiliations

    • Department of Dermatology, University of Rochester Medical Center, Rochester, NY
    • Corresponding Author InformationReprint requests: Lisa A. Beck, MD, University of Rochester, Department of Dermatology, 601 Elmwood Ave, Box 697, Rochester, NY 14642.

Received 22 July 2010; received in revised form 10 September 2010; accepted 14 October 2010. published online 16 December 2010.

Article Outline

Background

Atopic dermatitis (AD) is characterized by dry skin and a hyperactive immune response to allergens, 2 cardinal features that are caused in part by epidermal barrier defects. Tight junctions (TJs) reside immediately below the stratum corneum and regulate the selective permeability of the paracellular pathway.

Objective

We evaluated the expression/function of the TJ protein claudin-1 in epithelium from AD and nonatopic subjects and screened 2 American populations for single nucleotide polymorphisms in the claudin-1 gene (CLDN1).

Methods

Expression profiles of nonlesional epithelium from patients with extrinsic AD, nonatopic subjects, and patients with psoriasis were generated using Illumina's BeadChips. Dysregulated intercellular proteins were validated by means of tissue staining and quantitative PCR. Bioelectric properties of epithelium were measured in Ussing chambers. Functional relevance of claudin-1 was assessed by using a knockdown approach in primary human keratinocytes. Twenty-seven haplotype-tagging SNPs in CLDN1 were screened in 2 independent populations with AD.

Results

We observed strikingly reduced expression of the TJ proteins claudin-1 and claudin-23 only in patients with AD, which were validated at the mRNA and protein levels. Claudin-1 expression inversely correlated with TH2 biomarkers. We observed a remarkable impairment of the bioelectric barrier function in AD epidermis. In vitro we confirmed that silencing claudin-1 expression in human keratinocytes diminishes TJ function while enhancing keratinocyte proliferation. Finally, CLDN1 haplotype-tagging SNPs revealed associations with AD in 2 North American populations.

Conclusion

Collectively, these data suggest that an impairment in tight junctions contributes to the barrier dysfunction and immune dysregulation observed in AD subjects and that this may be mediated in part by reductions in claudin-1.

Key words: Atopic dermatitis, claudin-1, tight junctions

Abbreviations used: AA, African American, AD, Atopic dermatitis, ADVN, Atopic Dermatitis and Vaccinia Network, CLDN1, Claudin-1 gene, EA, European American, EASI, Eczema Area and Severity Index, FITC, Fluorescein isothiocyanate, FLG, Filaggrin gene, GAPDH, Glyceraldehyde-3-phosphate dehydrogenase, LD, Linkage disequilibrium, OPA, Oligonucleotide pool assay, OR, Odds ratio, PCl/PNa, Relative permeability of Cl and Na+, PHK, Primary human foreskin keratinocyte, qPCR, Quantitative PCR (eg, real-time PCR), SNP, Single nucleotide polymorphism, SC, Stratum corneum, siRNA, Small interfering RNA, TEER, Transepithelial electrical resistance, TEWL, Transepidermal water loss, TJ, Tight junction, ZO, Zonulae occludens

 

Discuss this article on the JACI Journal Club blog: www.jaci-online.blogspot.com.

Atopic dermatitis (AD) is the most common inflammatory skin disease, affecting up to 17% of children and about 6% of adults in the United States.1, 2 Its cardinal features include dry eczematous skin lesions, a relapsing and often chronic course, and an intense intractable pruritus. Many of these features have been attributed in part to an acquired and/or genetic epidermal barrier defects. Disturbance of the epithelial barrier is now recognized as a common feature in many inflammatory diseases, including inflammatory bowel disease, celiac disease, sinusitis, food allergy, asthma, and AD.3, 4 A defect in barrier has been argued to favor the penetration or reactivity to microbes, allergens/antigens, and irritants into the dermis and possibly contribute to the TH2 immune response observed in early AD lesions.5, 6, 7

The skin has 2 barrier structures: the stratum corneum (SC) and tight junctions (TJs).8 It is widely accepted in patients with AD that the SC is dysfunctional as the result of 1 or more of the following defects: (1) reduced levels of SC lipids9, 10, 11; (2) acquired or genetic defects in filaggrin (FLG)12, 13, 14 or other epidermal differentiation proteins; (3) acquired or genetic defects in proteases, antiproteases, or both13, 15; and/or (4) simply the consequence of the physical trauma from widespread scratching that predates the development of all skin lesions.

TJs function as the “gate” for passage of water, ions, and solutes through the paracellular pathway.16 TJs also regulate the localization of apical and basolateral membrane components. Whether epidermal TJs have this cell polarity function is still debated.17 Some investigators have speculated that TJs might regulate the lipid components found in the SC.18, 19 This has promoted the notion that these 2 epidermal barrier structures interact in a dynamic way to ensure that the skin is in fact a formidable barrier (Fig 1). The structure and function of keratinocyte TJs remains an area of active investigation. TJs are composed of a number of transmembrane proteins, such as the claudin family, junctional adhesion molecule A, occludin, and tricellulin. In addition, several scaffolding proteins, such as zonulae occludens (ZO)-1, ZO-2, ZO-3, multi-PDZ domain protein 1, membrane-associated guanylate kinase, and cingulin, have been identified in the TJ cytosolic plaque.18 Claudins are 4-transmembrane-spanning proteins that determine TJ resistance and permeability and include more than 24 members.20, 21, 22 Based on in vitro experiments, claudins have been divided into those that increase transepithelial electrical resistance (TEER) or enhance barrier, including claudin-1 and claudin-4, and claudins that reduce TEER and therefore disrupt barrier function, such as claudin-2 and claudin-6.23

Although the existence of TJ-like structures in the epidermis has been suggested for some time,24 the functional relevance of these structures has been addressed only recently.21, 25, 26 A major breakthrough came in 2002, when Furuse et al27 reported that claudin-1–deficient mice died within 24 hours of birth with wrinkled skin, severe dehydration, and increased epidermal permeability, as assessed by dye studies and transepidermal water loss (TEWL).27 Importantly, these mice had no abnormalities in the expression of SC proteins (eg, loricrin, involucrin, transglutaminase-1, or Krueppel-like factor 4) or lipids that might explain the severe skin phenotype. Although this murine model clearly established the importance of claudin-1 in skin barrier function, very little is currently known about the role of claudin-1 (or TJs) in human skin diseases.

Dysfunction of keratinocyte TJs could explain many of the consequences of a defective skin barrier. For example, increased TEWL, which is a well-established measure of skin barrier integrity and is notably increased in both lesional and nonlesional skin of patients with AD, is not attributable to FLG mutations (Fig 1).28, 29, 30, 31 Thus other genetic or acquired defects in the skin barrier likely explain increased TEWL. Defective structure and function of TJs could also have immunologic consequences (Fig 1). For example, Kubo et al32 recently demonstrated that activated Langerhans cells, the resident antigen-presenting cell in the epidermis, gain access to foreign antigens by sending dendrites out through epidermal TJs.32 It seems likely that Langerhans cells will be more likely to sample surface antigens and allergens when epidermal TJs are compromised. This, coupled with the recent evidence that Langerhans cells may be specialized to induce the differentiation of naive CD4+ T cells to TH2 cells, strongly supports the notion that a breach in TJs is likely a critical feature in the initiation of AD.33

  • View full-size image.
  • Fig 1. 

    Skin epithelium is uniquely armed with 2 barrier structures: the SC and TJs. The SC is the outermost structure, consisting of multiple layers of enucleated keratinocytes called corneocytes. The SC barrier is maintained by the complex interaction of the cornified envelope, intracytoplasmic moisturizing factors, and a complex lipid mixture in the extracellular space.8 TJs are located just below the SC at the level of the stratum granulosum. In this article we present evidence that this structure might be compromised in patients with AD, and this may be due to reductions in claudin-1 levels. These 2 barrier structures interact in a dynamic way to ensure that the skin maintains a formidable barrier. It is our premise that SC defects alone would not lead to the development or exacerbation of AD. We propose that a breach in both the SC and TJs would be required for sensitization to antigens/allergens, irritants, microbes, pollutants, or possibly even nanoparticles. A recent study demonstrates that the transient disruption of TJs results in the incorporation of Langerhans cell dendrites within a temporary TJ.32 This extension of the Langerhans cell dendrite would enable antigen uptake and processing and might confer activation signals that would determine the immunologic fate of the antigen-presenting cell–T-cell interaction that follows. A fluorescence image of healthy human epidermis (left) demonstrates the expression patterns of 2 key players in AD pathogenesis, namely FLG (red) and CLDN1 (green), and pictorially highlights the orientation of the 2 skin barrier components. DAPI, 4′,6-Diamidino-2-phenylindole; INV, involucrin; LOR, loricrin.

In the current study we report for the first time the reduced expression of a key TJ protein, claudin-1, in AD epidermis, which was not observed in patients with psoriasis, a TH17-polarized inflammatory skin disease also associated with barrier defects.34, 35 In vitro findings confirm that reductions in claudin-1 expression, comparable with those observed in human skin samples, significantly affect TJ function by using 2 different measures of TJ integrity. Our ex vivo studies with full-thickness epidermal samples demonstrate remarkable bioelectric defects in AD nonlesional skin and provide more insight into the mechanism of epidermal barrier dysfunction characteristic of AD. Preliminary single nucleotide polymorphism (SNP) analysis suggests that the claudin-1 gene (CLDN1) might be a novel susceptibility gene for AD. Collectively, our studies strongly suggest that claudin-1 might be a key determinant of skin barrier dysfunction in patients with AD and may play a role in the TH2 polarization characteristically observed in most subjects.

Back to Article Outline

Methods 

Study participants: Expression profiling and validation experiments 

The diagnosis of AD was made using the US consensus conference criteria.36 All patients with AD had extrinsic disease, as defined by a serum total IgE level 2 SDs or more of age-dependent norms and a positive multiallergen RAST result (ImmunoCap Phadiatop). Nonatopic healthy subjects were defined as having no personal or family history of atopic diseases, no personal history of chronic skin or systemic diseases, and a serum total IgE level that was 2 SDs or less of age-dependent norms and a negative Phadiatop. The diagnosis of psoriasis was based on characteristic clinical features of plaque-type lesions by a board-certified dermatologist. Exclusion criteria were as follows: age of 18 years or less or 60 years or greater, use of systemic immunosuppressive therapy, use of leukotriene inhibitors within the last 6 weeks, use of topical steroids or calcineurin inhibitors within the last 6 weeks at the site of blister formation or biopsy, and presence of a recent systemic infection or course of oral antibiotics within the last 2 weeks. All subjects either underwent an epidermal procurement procedure (see below) or a 4-mm punch biopsy of their non–sun-exposed forearm. These studies were approved by the Research Subject Review Boards at the Johns Hopkins Medical Institution, the University of Rochester Medical Center, or both. All subjects provided written informed consent.

Epidermal procurement and processing 

An NP-2 negative pressure vacuum apparatus (Electronic Diversities, Finksburg, Md) was applied to the volar forearm (Fig 2, B-D). The blister roof, which consists of full-thickness epidermis, was removed by using a sterile technique and placed in Hank's balanced salt solution (Invitrogen, Carlsbad, Calif). Total RNA was extracted from epidermis by using the QIAshredder spin column and RNeasy RNA isolation kits (Qiagen, Hilden, Germany). The quality of total RNA samples (RNA integrity number) was assessed by using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, Calif). Samples were selected for microarray analysis if they had a good RNA integrity number (range, 8-10).

  • View full-size image.
  • Fig 2. 

    Intercellular junction proteins are dysregulated in patients with AD. A-D, z ratios from gene arrays performed on nonlesional epithelium (blister roofs; B-D). Claudin-1 and claudin-23 levels were reduced, whereas the gap junction proteins connexin-26 (GJB2) and connexin-62 (GJA10) were upregulated (Ared). Expression of genes indicative of dedifferentiation were either unaffected or increased (A, yellow). E and F, Validation of the key genes in newly recruited AD/nonatopic (NA) control samples. P = .03 and ∗∗P = .001. GJA and B, gap junction; IVL, involucrin; OCLN, occludin; PPL, periplakin; SPRR, small proline rich proteins; TGM1, transglutaminase 1; TJP1-3, ZO-1 to 3.

Gene expression profiling 

Biotin-labeled complementary RNA was prepared from total RNA according to the manufacturer's protocol (Illumina, San Diego, Calif). Complementary RNA was hybridized to Illumina Sentrix HumanRef-8 Expression BeadChips (Illumina), which contain 24,350 probes corresponding to 21,429 unique genes. Signal intensity quantification was performed with an Illumina BeadStation 500GX Genetic Analysis Systems scanner.

Preliminary analysis of the scanned data was performed with Illumina BeadStudio software, which returns single-intensity data values for each probe after the computation of a trimmed mean average for each probe represented by a variable number of bead probes on the array. Z transformation for normalization was performed on each Illumina sample/array on a stand-alone basis, and z ratios were calculated by taking the difference between the averages of the observed gene z xscores and dividing by the SD of all the differences for that particular comparison.37 Significant changes in gene expression between class pairs were calculated by using the z test,38 and significant genes were defined as those that satisfy a z test P value of ± 1.5E-3. The BeadStudio expression values for each sample/array were scaled to have a median of 256 and then log2 transformed.

Quantitative PCR 

Quantitative PCR (qPCR) was performed with the iScript cDNA Synthesis kit and the iQ SYBER Green Supermix assay system (Bio-Rad Laboratories, Hercules, Calif). All PCR amplifications were carried out in triplicate on an iQ5 Multicolor real-time PCR detection system (Bio-Rad Laboratories). Primers were designed and synthesized by Integrated DNA Technologies (see Table E1 in this article's Online Repository at www.jacionline.org). Relative gene expression was calculated by using the 2-ΔΔCt method.39 The normalized threshold cycle value of each sample was calculated by using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an endogenous control gene.

Imaging of TJ proteins 

For immunohistochemical staining, the following antibodies were used: claudin-1 (0.2 μg/mL, JAY.8; Zymed, South San Francisco, Calif), occludin (2.5 μg/mL, OC-3F10; Zymed), ZO-1 (2.5 μg/mL, ZO1-1A12; Zymed), or isotype control. Five-micrometer sections from formalin-fixed skin biopsy specimens were deparaffinized and rehydrated. Slides were incubated in 1× EDTA solution, pH 8.0, at 95°C for 10 minutes. Samples were incubated overnight at 4°C, with primary antibodies titered to the lowest concentration that produced immunoreactivity in control samples. The secondary antibodies and detection system used were reported previously.40 For immunofluorescence labeling, skin samples were incubated in blocking solution (5% BSA, 0.1% saponin, and 1 mmol/L calcium in PBS) for 20 minutes, followed by 90 minutes of incubation with primary antibodies diluted in blocking solution. This was followed by a 1-hour incubation with secondary antibodies: 1:1,000 AlexaFluor 488 donkey-anti-rabbit IgG H+L (Molecular Probes, Eugene, Ore), 1:1,000 Alexa Fluor 568 donkey–anti-mouse IgG H+L (Molecular Probes), and 1:10,000 4′,6-diamidino-2-phenylindole (Molecular Probes). Primary human keratinocytes (PHKs) grown on transwell filters or a glass cover slip were fixed in methanol at −20°C for 15 minutes, followed by blocking in PBS with 1% BSA and immunolabeled with the above TJ antibodies.

Fluorescent images were obtained with an Olympus FV1000 laser scanning confocal microscope (Olympus, Tokyo, Japan) using the FV10-ASW 1.7 software (Olympus). The Alexa Fluor 488 and 568 signals were imaged sequentially in frame interlace mode to eliminate crosstalk between channels. The saturation level of fluorescence intensity was set for the controls by using the Hi-Lo feature of the Fluoview software. For each experiment, the images were captured at identical settings during image acquisition, and no manipulations of the images occurred before importing into the FV1000 software at the workstation.

Ex vivo electrophysiologic measurements in Ussing chambers 

Isolated blister roofs (1 cm in diameter; Fig 2, B-D) were placed in the Ussing chamber in 2-mm-diameter sliders for Snapwell chambers (area, 0.031 cm2; Physiologic Instruments, San Diego, Calif), bathed in Ringer lactate, and gassed with a mixture of 95% O2 and 5% CO2. The tissues were continuously voltage clamped to zero by using VCC MC8 (Physiologic Instruments). Transepithelial short-circuit current (expressed as micro-Angstroms per square centimeter of tissue surface area) was measured, and total tissue conductance (expressed as milliSiemens [mS] per square centimeter of tissue surface area) was calculated with Ohm's law by applying a 5-mV transepithelial pulse every 20 seconds and measuring the resulting current deflections.

Dilution potential measurements were performed to determine the changes in the permeability ratio between Na+ and Cl by using the Nernst equation.41, 42, 43 Briefly, the tissues were allowed to equilibrate in the Ussing chamber for 45 minutes. Ten nanomoles per liter of bumetanide was added to both the apical/corneum and basolateral/basal bathing solutions to block Na+-K+-2Cl cotransport, which feeds transepithelial Cl secretion through apical channels. Dilution potentials were induced by means of apical perfusion, basolateral perfusion, or both with Ringer solutions containing 2 different concentrations of Na+ (140 and 70 mmol/L) and Cl (119.8 and 50 mmol/L), and the remainder was replaced with mannitol to maintain equal osmolarity between experiments. Dilution potentials were corrected for changes in junction potential (usually <1 mV). Changes in membrane voltage (Em), along with known concentrations of Na+ and Cl in the respective solutions, were substituted in the modified Nernst equation to determine the change in permeability ratio between Cl and Na+ (PCl[Cl]i/PNa[Na]i).

Permeability studies in Ussing chambers 

For the permeability assay, 0.02% fluorescein isothiocyanate (FITC)–albumin (Sigma, St Louis, Mo) was added to the apical side of the inserts, and buffer samples were collected at several time points (0.5-3 hours) from the other side of the membrane. Permeability was assessed by using a spectrophotometer (Multiskan EX; Thermo Electron Corporation, Vantaa, Finland) at 490 nm. Permeability data were expressed as FITC fluorescence intensity normalized to sample area and time (OD per square centimeter per hour).

Culture of foreskin PHKs 

Human keratinocytes were isolated from neonatal foreskin.44 PHKs were cultured in Keratinocyte-SFM (Invitrogen/Gibco) with 1% Pen/Strep and 0.2% Amphotericin B (Invitrogen/Gibco). Cells were grown in Dulbecco modified Eagle medium (Invitrogen/Gibco) with 10% heat-inactivated FBS (Invitrogen/Gibco) and 1% Pen/Strep and 0.2% Amphotericin B (Invitrogen/Gibco) to differentiate PHKs. For TJ modulation experiments, the following cytokines were added alone or in combination to the differentiation media: human IL-4 (50 ng/mL; R&D Systems, Minneapolis, Minn) and IL-13 (50 ng/mL, R&D Systems).

TEER and paracellular flux 

PHKs were plated at a subconfluent density of 2.5 to 3 × 104 cells per filter in Transwell insert and cultured in Keratinocyte-SFM media until confluent. TEER was measured with an EVOMX voltohmmeter (World Precision Instruments, Sarasota, Fla). The resistance of cell-free filters was subtracted from each experimental value.

To evaluate the paracellular flux of PHKs, 0.02% fluorescein (FITC) sodium (Sigma) in Hanks buffered saline solution was added to the upper chamber. Samples were collected from the lower chamber at different times (0.5-3 hours). The amount of FITC that had diffused from the apical to the basal side of the filter was measured with a spectrofluorimeter (Multiskan EX, Thermo Scientific, Milford, Mass), with excitation/emission wavelengths of 490/514 nm. Paracellular permeability was presented as follows:

Relative fluorescence flux = Experimental condition/Filter alone × 100.

Immunoblotting 

PHKs were lysed on ice in RIPA lysis buffer (20 mmol/L Tris; 50 mmol/L NaCl; 2 mmol/L EDTA; 2 mmol/L ethyleneglycol-bis-(β-aminoethylether)-N,N,N′,N′-tetraacetic acid; 1% sodium deoxycholate; 1% TX-100; and 2% SDS, pH 7.4), with 1:100 Protease Inhibitor Cocktail (Sigma) and 1:100 Phosphatase Inhibitor Cocktail (SigmaCells) for 30 minutes at 4°C. The samples were heated at 95°C for 10 minutes and then centrifuged at 14,000 rpm for 15 minutes. Forty micrograms of protein, as determined by means of BCA (Pierce, Cheshire, United Kingdom) in NuPage LDS Sample Buffer (Invitrogen), was applied to 4-12% NuPage Bis-Tris gels (Invitrogen). Electrophoresis was performed under reducing conditions with MES SDS Buffer (Invitrogen). Membranes were incubated in blotting solution (5% nonfat dry milk in PBS plus 0.05% Tween 20) at room temperature for 1 hour and then incubated with primary antibodies: claudin-1 (JAY.8; Zymed), occludin (OC/3F10; Zymed), and GAPDH (FL-355; Santa Cruz Biotechnology, Santa Cruz, Calif). A horseradish peroxidase–linked secondary antibody (GE Healthcare, Fairfield, Conn) was used with ECL (GE Healthcare) to visualize bands by means of autoradiography with Kodak BioMax MR film (Kodak, Rochester, NY). The pixel intensity of each band was estimated with Image J software.

RNA interference 

PHKs were plated on glass cover slips at 2 to 3 × 105 cells per well in a 6-well plate or at 2 to 3 × 104 cells per filter in a Transwell insert (Costar; PET membrane, 0.4-μm pore size, 6.5-mm insert) in Keratinocyte-SFM without antibiotics. The next day after plating, cells were transfected with claudin-1–specific or control (scrambled) small interfering RNAs (siRNAs; Santa Cruz Biotechnology) by using Lipofectamine 2000 transfection Reagent (Invitrogen). TEER, permeability, and proliferation experiments were conducted 48 hours after PHKs were switched to differentiation media.

Proliferation assay 

To evaluate cell proliferation we used Click-iT EdU (5-ethynyl-2′-deoxyuridine) kit following manufacturer's instructions (Molecular Probes, Eugene, Ore). Cells were stained with DAPI was to identify nuclei and assess cell density. For each sample, 6 random fields (magnification ×200) were captured. EdU positive cells were counted by 2 investigators blinded to the conditions, and results expressed as mean EdU positive cells/hpf.

Genetic study participants 

DNA was isolated by using standard protocols from 258 unrelated European American (EA) patients with AD and 156 healthy control subjects participating in the Atopic Dermatitis and Vaccinia Network (ADVN). The same set of markers was genotyped in 176 African American (AA) patients with AD and 152 healthy control subjects. Baseline characteristics are presented in Table I, and further details can be found in previous publications.45 AD was diagnosed by using the US consensus conference criteria.36 Nonatopic healthy control subjects were defined as having no personal history of chronic disease, including atopy. AD severity was defined according to the Eczema Area and Severity Index (EASI), a standardized grading system,46 and total serum IgE levels were measured. The study was approved by the institutional review boards at National Jewish Health, Johns Hopkins University, Oregon Health & Science University, University of California San Diego, Children's Hospital of Boston, and University of Rochester Medical Center. All subjects provided written informed consent before participation.

Table I. ADVN genetics study demographics
EA subjectsAA subjects
CharacteristicPatients with ADNonatopic subjectsPatients with ADNonatopic subjects
Sample size258156176152
Male subjects, no. (%)96 (37.2)63 (40.4)43 (24.4)77 (50.7)
Age (y), mean (SD)33.1 (18.5)36.6 (13.2)35.3 (12.5)41.1 (10.3)
AD onset <5 y, no. (%)178 (68.9)NA91 (51.7)NA
Geometric mean IgE levels (95% CI)670.0 (502-895)59.1 (48-111)556.8 (425-729)141.2 (113-299)
Geometric mean EASI (95% CI)4.6 (3.9-5.4)NA4.0 (3.3-4.9)NA
FLG null allele carrier, no. (%)65 (25.2)9 (5.8)11 (6.2)2 (1.3)

NA, Not applicable.

EASI was determined by the percentage of eczema area on a 7-point ordinal scale: 0, no eruption; 1, <10%; 2, 10% to 29%; 3, 30% to 49%; 4, 50% to 69%; 5, 70% to 89%; and 6, 90% to 100%.

Genotyping and quality control 

We performed genotyping on genomic DNA extracted from blood samples with the MagAttract DNA blood Mini M48 kit (Qiagen) on a Biorobot M48, according to the manufacturer's instructions. DNA quantification was performed with Pico-Green (Molecular Probes). Genotyping in these samples was determined for each of the selected tagging SNPs with the Illumina GoldenGate custom panel containing 384-plex assays according to the manufacturer's protocol (Illumina).

Tagging SNPs were selected to represent the CLDN1 gene in both the EA and AA groups. The SNP selection approach was to examine 10 kb upstream and 10 kb downstream in accordance with design score validations based on Illumina in-house measurements and the 60-bp limitation (an SNP cannot be closer than 60 bp to another SNP on this oligonucleotide pool assay [OPA]). We initially selected all available CLDN1 SNPs from the HapMap (http://www.hapmap.org/) to tag the linkage disequilibrium (LD) blocks in each of the ethnic groups (EA and AA subjects). Tagging was based on the LDSelect algorithm,47, 48 with a minor allele frequency of 10% or greater and an r2 threshold of 0.80 (as reported in HapMap) to ensure nearly perfect LD and infer information on all SNPs captured by the tag set. A final selection included 27 SNPs chosen for the Illumina OPA. Of the 27 tagging SNPs selected, 24 qualified as tagging SNPs from both the HapMap CEPH Utah (CEU, with European ancestry) and the HapMap Yoruba (YRI, with African ancestry) samples; an additional 3 tagging SNPs (rs6800425, rs1155884, and rs9809713) were genotyped only in the AA subjects. Two LD blocks were observed among the EA group (block 1: rs10212165, rs3954259, and rs9290929 [D′ = 0.982-1.0]; block 2: rs9835663 and rs3732923 [D′ = 0.976]), and 3 LD blocks were observed among the AA group (block 1: rs3954259 and rs9290929 [D′ = 1.0]; block 2: rs893051, rs9839711, and rs9835663 [D′ = 0.957-1.0]; block 3: rs6800425 and rs3774028 [D′ = 1]) by using the criteria of Gabriel et al.49

The 27 SNPs were genotyped by using the custom-designed Illumina OPA for the BeadXpress Reader System and the GoldenGate Assay with VeraCode Bead technology (San Diego, Calif), according to the manufacturer's protocol.50 Genotyping quality was high, with an average completion rate of 97.2% to 98.2% for the BeadXpress genotyping (see the complete Methods section in this article's Online Repository at www.jacionline.org).

All samples were also genotyped for the 2 FLG mutations most commonly associated with AD in EA subjects (R501X and 2282del4), plus 9 additional polymorphisms (rs12730241, rs2065956, rs11582620, rs3126082, rs6587665, rs11204980, rs1933063, rs1933064, and rs3126091), as previously described.51 Interaction among FLG mutations previously associated with AD and haplotype-tagging SNPs in FLG and CLDN1 SNPs were investigated by using PLINK epistasis. DNA samples from subjects enrolled for the immunostaining study were also genotyped for the same 2 FLG null mutations.

Statistical analysis 

Data were expressed as means ± SEMs of 3 or more experiments. Differences between groups were evaluated by using an appropriate t test. A P value of .05 or less was considered statistically significant. The statistical analyses performed as part of the expression profiling or SNP analyses are described in that section. The Cochran-Armitage trend test was used to test for association between each individual marker (under an additive model) and disease status with PLINK software (http://pngu.mgh.harford.edu/∼purcell/plink/to). Analyses were performed for subjects of European and African ancestry separately to minimize confounding caused by racial differences in polymorphism frequency. We tested for association between genetic markers and the quantitative measure of severity, EASI, by using recessive logistic regression models. Departures from Hardy-Weinberg equilibrium at each locus were tested by means of the χ2 test separately for cases and control subjects by using PLINK; all SNPs were in Hardy-Weinberg equilibrium. Tests for association with a P value of less than .05 were then confirmed with the PLINK max(T) test by using 10,000 permutations.

Back to Article Outline

Results 

Claudin-1 expression is markedly reduced in nonlesional AD epidermis 

To characterize and quantify the expression of human epidermal proteins important for barrier function, we performed gene expression profiling of nonlesional or clinically unaffected epidermis by using blister roofs from patients with AD, patients with psoriasis, and nonatopic subjects (Fig 2, B-D). The Illumina Sentrix HumanRef-8 Chip contained 43 TJ genes (see Table E2 in this article's Online Repository at www.jacionline.org), 8 gap junction genes, and 41 epidermal differentiation complex genes. A number of the epidermal differentiation complex genes were differentially expressed in epidermis from patients with AD versus nonatopic nonlesional epidermis, and several (eg, S100A8, S100A7, FLG, and LOR; see Fig E1 in this article's Online Repository at www.jacionline.org) corroborate the findings observed by others in lesional skin biopsy specimens.52, 53 Of note, FLG was downregulated in patients with AD versus nonatopic subjects (z ratio, −5.29); however, the P value of .01 did not reach the significance threshold. Using the expression profiling array data from nonatopic control subjects, we verified that human keratinocytes express claudin-1, claudin-4, claudin-8, claudin-12, and claudin-1454, 55, 56 and demonstrated for the first time that they also express claudin-15 and claudin-23 (Illumina detection values ≥ 0.99, data not shown). Interestingly, of the intracellular junction genes, claudin-1 met our criteria for significance, demonstrating reduced expression in patients with AD with a z ratio of −2.4 and a P value of .0013 compared with nonatopic subjects (Fig 2, A, red highlights). We observed no difference in claudin-1 expression in patients with psoriasis compared with that seen in nonatopic control subjects (P = .98; Fig 2, A, red highlights). We also noted reduced expression of claudin-23 (z ratio, −3.2; P = .0062) in AD epithelium compared with that from nonatopic subjects, but the difference was only marginally significant (Fig 2, A, red highlights). Furthermore, patients with AD displayed enhanced expression of the gap junction proteins connexin-26 (GJB2; z ratio, +5.2; P = .025) and connexin-62 (GJA10; z ratio, +1.6; P = .001; Fig 2, A, red highlights). Patients with AD did not show decreased expression of proteins relevant for adherens junctions or desmosomes (data not shown). Importantly, the expression of a number of differentiation genes was either not affected or increased in patients with AD compared with that seen in control subjects (Fig 2, A, yellow-highlighted genes), indicating that the observed changes in TJ genes did not simply reflect dedifferentiation of the epidermis. We confirmed the reduced expression of claudin-1 in blister roofs obtained from newly recruited patients with AD and nonatopic subjects (n = 5 per group) by means of qPCR (patients with AD: 38.4 ± 7.1 relative value units vs nonatopic subjects: 69.7 ± 9.5; P = .03; Fig 2, E). We also confirmed the reduced expression of claudin-23 (patients with AD: 0.23 ± 0.04 relative value units vs nonatopic subjects: 0.81 ± 0.12; P = .001) and the enhanced expression of connexin-26 (GBJ2; patients with AD: 18.87 ± 6.7 vs nonatopic subjects: 3.73 ± 0.26; P = .03) in patients with AD versus nonatopic control subjects by means of qPCR (Fig 2, F). Although we considered the reduced expression of claudin-23 in AD samples very interesting, we were limited in our ability to pursue this finding by the lack of reliable reagents. Additional studies are clearly needed to clarify the role played by claudin-23 in epidermal barrier function.

To investigate claudin-1 expression in intact skin, we compared skin biopsy specimens from nonlesional AD skin with those from nonatopic subjects by using both immunohistochemistry (Fig 3, A and B) and immunofluorescent/confocal microscopy (Fig 3, C and D). Claudin-1 immunoreactivity was detectable in bright-field images in all suprabasal layers, whereas occludin and ZO-1 were detected only in the upper granulosum layer where TJs form (data not shown). This pattern has been noted by other investigators.16, 57 Importantly, the expression of claudin-1 was markedly reduced in nonlesional skin from patients with AD compared with that seen in nonatopic control subjects (Fig 3, A-D). Semiquantitative claudin-1 scoring confirmed the markedly reduced staining (≥50%) in the epidermis of patients with AD (1.3 ± 0.3) compared with that seen in nonatopic subjects (2.9 ± 0.1, P < .0004), and the highly significant P value demonstrates the remarkable uniformity of staining intensity within each group (Fig 3, E). Immunofluorescent staining more clearly demonstrated claudin-1 immunoreactivity on the cell membranes. The signal intensity was again significantly less in AD samples (Fig 3, C and D). These findings provide the first indication, to our knowledge, that the skin barrier defect in patients with AD might extend beyond the SC and include TJs.

  • View full-size image.
  • Fig 3. 

    Claudin-1 expression is markedly reduced in AD epidermis. A and B, Reduced claudin-1 immunoreactivity was noted in nonlesional AD skin (n = 11; A) compared with skin from nonatopic subjects (n = 12; B). Red indicates positive staining (bar = 100 μm). C and D, By using an FITC-conjugated secondary antibody, claudin-1 had a membranous pattern in both patients with AD (C) and nonatopic control subjects (D). The signal intensity was significantly reduced in AD epidermis (C). Positive staining is indicated in green (bar = 20 μm). The dotted line denotes the epidermal-dermal junction. E, Semiquantitative scoring confirmed reduced epidermal expression of claudin-1 in patients with AD (1.3 ± 0.3) compared with that seen in nonatopic (NA) subjects (2.9 ± 0.1, P < .0004).

AD epidermis shows defective bioelectric properties 

We next investigated the functional impairment of TJ barrier in AD epidermis by measuring bioelectric characteristics in Ussing chambers. This approach has been used in human and murine models to evaluate the TJ bioelectric property of mucosal epithelia.58, 59 The technique is based on the principle that an intact semipermeable membrane will maintain the electrochemical potential gradient generated artificially by bathing each side of the epidermal sheets with solutions of different ionic strength.60, 61 A leaky membrane will allow easy diffusion across the membrane and thus loss of electrochemical potential. Thus the higher the permeability across a membrane, the lower the potential gradient.59, 62 TEERs were stable and typically quite high, indicating intact paracellular barrier function of the electrically active epithelium. Using this approach, AD epidermis showed a dramatically lower resistance (92.0 ± 22.0 Ω × cm2, n = 3) compared with the nonatopic subjects (827.0 ± 173.3 Ω × cm2, P = .01, n = 4; Fig 4, A). The lower resistance observed in the Ussing chambers was consistent with the increased permeability of FITC-conjugated albumin in AD samples (445 ± 24 OD/cm2/h, n = 3) compared with nonatopic samples (175 ± 68 OD/cm2/h, P = .02, n = 4; Fig 4, A).

  • View full-size image.
  • Fig 4. 

    AD epidermis has altered bioelectric properties compared with epidermis from nonatopic (NA) control subjects. A, Ussing chamber measurements reveal a markedly reduced resistance (92 ± 22 Ω × cm2, n = 4) in AD epithelium compared with that from control subjects (827 ± 173 Ω × cm2, P = .01, n = 4). This was reflected in an increased permeability to FITC-conjugated albumin in patients with AD (445 ± 24 OD/cm2/h, n = 4) compared with that seen in nonatopic control subjects (175 ± 68 OD/cm2/h, P = .02, n = 4). B, Dilution potential studies noted the preservation of membrane selectivity in nonatopic subjects, with Na+ ions relatively more permeable than Cl ions (0.77 ± 0.03–fold PCl/PNa). In contrast, the selectivity was completely lost in AD epidermis (1.10 ± 0.02–fold PCl/PNa, P = .001, n = 3 per group), and both ions were equally permeable.

To better investigate the paracellular permeability properties, we measured the relative permeability of Cl and Na+ (PCl/PNa).42 If PCl/PNa is equal to 1, then there is no selectivity and the membrane is freely permeable. Dilution potential studies on epidermal sheets showed that membrane selectivity is preserved in skin from nonatopic subjects, with Na+ ions relatively more permeable than Cl ions (0.77 ± 0.03–fold PCl/PNa). However, in samples from patients with AD, the selectivity was completely lost (1.10 ± 0.02–fold PCl/PNa, P = .001, n = 3/group) because both ions were equally permeable (Fig 4, B).

Claudin-1 expression inversely correlated with TH2 biomarkers 

To address whether expression levels of epidermal claudin-1 might modulate adaptive immune responses, we looked at the relationship between claudin-1 mRNA expression in our epidermal samples from patients with AD, patients with psoriasis, and nonatopic control subjects and biomarkers of TH2 polarity, namely serum total IgE levels and peripheral blood eosinophilia (Fig 5, A and B). Claudin-1 levels were inversely correlated with both total IgE levels (r = −0.718, P = .0038) and eosinophil numbers (r = −0.761, P = .0016), suggesting that reductions in this key TJ barrier protein might affect the character of the immune response to environmental allergens or vice versa.

  • View full-size image.
  • Fig 5. 

    Claudin-1 expression from the gene arrays correlates with TH2 biomarkers. A, The line represents the linear least square fit for log2 CLDN1 expression level versus log10 total serum IgE level (Pearson product-moment correlation coefficient [n = 14]: r = −0.718, P = .0038). B, The plot of log2 CLDN1 expression level versus log10 total eosinophil count (n = 14; r = −0.761, P = .0016). The disease phenotypes (psoriasis [PS], AD, and nonatopic control subjects [NA]) are denoted by unique symbols.

Claudin-1 localizes to TJs only in differentiated human keratinocytes 

Claudin-1 protein is expressed in PHKs in vitro but colocalizes with other TJ proteins at the cell membrane only after Ca2+-induced differentiation (Fig 6, A). Confocal microscopy demonstrated that claudin-1 colocalizes with occludin and ZO-1 at the areas of cell-cell contact only in PHKs grown in media with a high concentration of Ca2+ (Hi Ca, 1.9 mmol/L) for at least 24 hours after confluency. Interestingly, in undifferentiated PHKs grown in 0.3 mmol/L Ca2+ (Lo Ca)–containing media, claudin-1 immunoreactivity was faint and largely nuclear or perinuclear, whereas occludin was undetectable (Fig 6, A), and ZO-1 was localized on the membrane with a discontinuous pattern (data not shown).

  • View full-size image.
  • Fig 6. 

    Claudin-1 colocalizes with other TJ proteins at the cell membrane in differentiated keratinocytes, and this coincides with TJ function. A, In Ca2+-differentiated PHKs (Hi Ca) claudin-1 (green) colocalizes with occludin (red) at the cell membrane (bars = 50 μm). B, TEER is only observed in differentiated PHKs and peaks about 40 hours after the increase in Ca2+ level (representative of n = 5). C, Paracellular diffusion of 0.02% sodium fluorescein is markedly reduced in differentiated PHKs (3.1 ± 0.6–fold, P = .046, n = 3). D, Western blots show enhanced expression of claudin-1 when PHKs were differentiated for 48 hours in the presence of stimulation with IL-4 (50 ng/mL), IL-13 (50 ng/mL), or both cytokines (representative of n = 3).

Next we investigated the functional relevance of these Ca2+-induced changes in TJ protein expression and localization. We observed during Ca2+-induced PHK differentiation a dramatic (approximately 300-fold) increase in TEER, which peaked between 30 and 60 hours after exposure to high extracellular Ca2+ (Fig 6, B) and confirmed previously published studies.27, 63, 64, 65, 66, 67 Additionally, we showed that sodium fluorescein flux was markedly reduced in differentiated PHKs (3.1 ± 0.6–fold, P = .046; Fig 6, C).

TH2 cytokines enhance claudin-1 expression and TJ barrier function 

Previous studies have shown that claudin-1 expression in noncutaneous epithelial cells can be modulated by cytokines and growth factors.68, 69, 70 Recent findings from murine models support the hypothesis that IL-4 could delay skin barrier recovery.71, 72 We therefore wondered whether claudin-1 downregulation observed in AD nonlesional skin biopsy specimens could be secondary to TH2 cytokines. A corollary to this hypothesis is that even nonlesional skin has been shown to express TH2 cytokines.73 To test this possibility, PHKs were differentiated in the presence or absence of TH2 cytokines, IL-4, and IL-13, and the expression of claudin-1, occludin, and ZO-1 was evaluated. We observed a significant enhancement of claudin-1 expression after IL-4 (48 hours, 50 ng/mL; 2.1 ± 0.4–fold over control subjects; P = .05; n = 3) and IL-13 (48 hours, 50 ng/mL; 1.6 ± 0.3–fold over control subjects; P = .1; n = 3) stimulation (Fig 6, D). No synergism was noted with either cytokine, and interestingly, we observed no effect on the expression of occludin and ZO-1 (data not shown). We then investigated the effect of IL-4 and IL-13 on PHK barrier function. A significant increase in TEER peak was observed in IL-4 (50 ng/mL)–treated PHKs (166 ± 24 Ω × cm2 vs 109 ± 11 Ω × cm2 for medium alone; P = .03; n = 4). Dose-response experiments confirmed IL-4's effect on TEER (dose range, 0.5-100 ng/mL; data not shown), whereas IL-13 (dose range, 0.5-100 ng/mL) induced only a slight increase in TEER (data not shown). The mechanisms by which TH2 cytokines paradoxically enhance barrier function in our PHKs is currently unknown, but these data suggest that the reduced claudin-1 expression and TJ dysfunction observed in patients with AD are not due to the actions of TH2 cytokines. Alternatively, we cannot rule out the possibility that AD epithelium would respond differently to TH2 cytokines, and therefore studies are planned to address this possibility. Therefore at this point we cannot exclude the possibility that the impaired barrier observed in AD epidermis is a consequence of the TH2 cytokines present in the underlying dermis.

Claudin-1 knockdown disrupts TJ function and increased PHK proliferation 

We used an RNA interference approach to evaluate the effect that claudin-1 reduction has on measures of TJ function (TEER and permeability) and proliferation. Fig 7, A, shows that claudin-1–specific siRNA induced a dose-dependent and significant (≤60%) decrease in protein expression compared with scrambled siRNA-transfected cells. Because the claudin-1 knockout mouse dies shortly after birth and our tissue staining demonstrated approximately 50% reduction in claudin-1 immunoreactivity in AD compared with nonatopic epithelium (Fig 3), we chose to perform our functional assessments with a dose of siRNA (100 nmol/L) that reduced claudin-1 transcripts by a similar amount (P = .01). With only a 50% reduction in claudin-1, TEER decreased by 50% or more (Fig 7, C; control: 164 ± 18 Ω × cm2 and CLDN1 siRNA: 81 ± 6 Ω × cm2; P = .007; n = 4), and permeability to sodium fluorescein increased by a similar extent (Fig 7, D; control: 28 ± 12 and CLDN1 siRNA: 52 ± 9; P = .026; n = 4) when compared with that seen in the scrambled siRNA-transfected PHKs. Yamamoto et al63 used a similar knockdown strategy but observed a more modest effect (14% reduction) on TEER and did not assess TJ function by using a permeability assay. We also investigated the effect of claudin-1 knockdown on connexin-26 (GJB2) because this was upregulated in AD array samples. We observed enhanced expression of connexin-26 in our knockdowns (1.7 ± 0.8–fold over control; P = .05; n = 6; see Fig E2 in this article's Online Repository at www.jacionline.org).

  • View full-size image.
  • Fig 7. 

    Claudin-1 silencing reduces TEER, increases paracellular permeability, and enhances cell proliferation. A, Western blots demonstrated a dose-dependent reduction of claudin-1 with CLDN1 siRNA (48 hours). No change was observed for occludin. B, Immunostaining confirmed that claudin-1, but not occludin, expression was reduced in differentiated PHKs after transfection with CLDN1 siRNA (bars = 50 μm). C, Claudin-1 knockdown significantly reduced TEER (control: 164.0 ± 18.2 and CLDN1 siRNA: 80.6 ± 6.4, P = .007, n = 4). D, Increased sodium fluorescein permeability (control: 27.6 ± 11.7 and CLDN1 siRNA: 52.5 ± 9.2, ∗∗P = .026, n = 4). E, Enhanced cell proliferation, as assessed by using the Click-iT EdU assay (∗∗P = 0.002, n = 3).

Using a proliferation assay based on EdU incorporation, we noted that claudin-1–depleted cells have more proliferating cells (21.6 ± 1.4 EdU-positive cells per high-powered field) compared with control (8.1 ± 2.0 EdU-positive cells per high-powered field; P = .002; n = 3; Fig 7, E). These studies confirm and extend (with permeability and proliferation assays) previously published studies,27, 63, 64, 65, 66, 67 which have implicated claudin-1 as a critical protein for the establishment of a functional paracellular epidermal barrier. The proliferation we observed in claudin-1 knockdowns suggests that this might be responsible for the enhanced epithelial thickness or acanthosis observed in nonlesional AD skin.

CLDN1 variants are associated with risk of AD 

Because our findings strongly implicated claudin-1 as a critical element in the risk of AD, we took advantage of the ongoing National Institute of Allergy and Infectious Diseases–funded ADVN, which is currently enrolling patients with AD and nonatopic subjects (reviewed in a previous publication45) to examine whether common variants in the human CLDN1 gene might be associated with susceptibility to AD and disease severity. Two independent groups (EA and AA subjects) of patients with AD and healthy control subjects were enrolled (Table I). In brief, AD was diagnosed by using the US consensus conference criteria,36 and AD severity was defined according to the EASI, a standardized grading system.46 Twenty-seven CLDN1 SNPs spanning a 31.5-kb region on chromosome 3q28-q29 were selected by using a haplotype-tagging approach, of which 24 were common to both ethnic groups (see Table E3 in this article's Online Repository at www.jacionline.org). Adjusting for 10,000 permutations, we observed the most significant associations for a lower risk of AD in the AA group for an intronic SNP (rs17501010) between the third and fourth exons of CLDN1 (odds ratio [OR], 0.5; 95% CI, 0.3-0.8; P = .003) and an adjacent SNP (rs9290927) downstream of rs17501010 that was associated with a higher risk of AD (OR, 1.8; 95% CI, 1.0-3.3; P = .004; Fig 8 and see Table E4 in this article's Online Repository at www.jacionline.org). SNP rs17501010 also showed a modest association with early-onset AD (<5 years of age: P = .04). In addition, 2 SNPs (rs893051 in intron 1 and rs9290929 in the promoter region) were associated with greater disease severity (OR, 1.5; 95% CI, 1.1-2.1; P = .010; and OR, 1.6, 95% CI, 1.1-2.3; P = .007, respectively; Fig 8 and see Table E4). Modest associations were observed in the EA group, including a promoter SNP (rs16865373) and lower risk of AD (OR, 0.5; 95% CI, 0.2-0.9; P = .034) and lower risk of early-onset AD (<5 years of age: OR, 0.4; 95% CI, 0.2-1.0; P = .034; Fig 8 and see Table E4). Haplotype analyses were performed but did not alter the evidence for association for any of the outcomes, including the FLG null mutation (eg, R501X and 2282del4) phenotype (data not shown). Considering the importance of FLG mutations in patients with AD and its subphenotypes, we also evaluated whether there was an interaction between haplotype-tagging SNPs in FLG and CLDN1. No significant interaction effect was found. Despite the limitations of relatively small sample sizes, these findings suggest that CLDN1 genetic variations might determine the risk for and severity of AD in ethnically diverse populations and that this appears to be independent of FLG.

  • View full-size image.
  • Fig 8. 

    Evidence for CLDN1 association with risk of AD, early-onset AD, and disease severity in 2 North American populations. The x-axis represents the physical position for each of 27 CLDN1 SNPS shown in relationship to the exonic structure of the CLDN1 gene on chromosome 3q.28-q29. The y-axis denotes the association test result as −log (P value) corresponding to representative symbols for each of the phenotypes. The standard cutoff for significance (P = .05) is shown as a horizontal solid line. Outcomes included risk of AD (diamonds), early age of onset (<5 years; triangle), and the clinical scoring system called EASI (circles) in AA (blue) and EA (green) populations.

Back to Article Outline

Discussion 

This is the first report, to our knowledge, implicating a TJ defect in patients with AD, a human skin disease that affects up to 15 million Americans. We demonstrated reduced expression of epidermal claudin-1 in AD nonlesional epidermis (Figs 2 and 3). This was specific for AD and not observed in patients with psoriasis, a TH17-driven inflammatory skin disorder (Fig 2). Although previous psoriasis publications have suggested that TJs might be altered in lesional epidermis, this has not been consistently observed by other groups.56, 74, 75, 76 Adapting the Ussing chamber to measure bioelectric properties of stratified squamous epithelium enabled us to characterize skin barrier properties from human subjects. Using this approach, we observed a remarkable alteration in the bioelectric characteristics of AD epidermis with markedly lower electrical resistance and higher albumin permeability that was associated with the loss of ion selectivity permeability (Fig 4). These defects are the signature of a TJ defect.

Our findings are highly consistent with observations made from genetically altered mice. For example, the claudin-1 knockout mouse dies within 24 hours of birth with wrinkled skin, severe dehydration, and increased epidermal permeability, as measured by dye studies and TEWL.27 Importantly, these mice have no abnormalities in the expression of SC proteins or lipids that might explain their severe skin phenotype. Another recent study reported disruption of the epidermal barrier and severe dermatitis in transgenic mice overexpressing an adhesion-deficient mutant of claudin-6 in the suprabasal compartment of the skin.77 Interestingly, a marked downregulation of claudin-1 expression was noted in these transgenic mice. It is tempting to speculate that the reduction in claudin-1 rather than the adhesion-defective claudin-6 per se was responsible for the barrier disruption observed in this mouse. Lopardo et al66 also observed reduced claudin-1 expression in the epidermis of p63 mutant mice. These mice have a severe skin phenotype and die of dehydration within 1 day of birth, similar to the claudin-1 knockout mice. In summary, these murine models have highlighted the critical importance of claudin-1 for a functional epidermal TJ.

Recently, a human syndrome caused by an exonic mutation in CLDN1 has been described.78, 79, 80 Patients with this syndrome, called neonatal ichthyosis-sclerosing cholangitis, have features in common with AD, namely erythema, dry flaky skin, and patchy alopecia, in addition to unique features, such as severe liver and gallbladder abnormalities that likely arise because of the importance of claudin-1 in the barrier integrity of bile canaliculi.78, 79

Our in vitro studies with PHK monolayers demonstrating a clear association between claudin-1 levels and TEER confirmed previous work.63, 81, 82 We extended these findings by demonstrating that claudin-1 knockdown also enhanced TJ permeability and proliferation (Fig 7). In our study the claudin-1 siRNA was target specific, with no changes observed in the expression or localization, of other critical TJ proteins (occludin and ZO-1), adherens junction components (E-cadherin and nectin-1) or SC proteins (filaggrin; see Fig E2 in this article's Online Repository at www.jacionline.org). Additionally, we were able to reduce claudin-1 expression by approximately 50%, which is similar to the reductions we observed in claudin-1 immunoreactivity of AD epidermis, and this resulted in a remarkable reduction (approximately 50%) in TJ function (based on both electrical resistance and permeability assays, Fig 7). Although immunolabeling data allow only a correlative link between claudin-1 expression and the development of the epidermal barrier, our RNA interference result demonstrated a causal connection between these 2 events (Fig 7).

Recent studies with different types of mammalian epithelia indicated that the epithelial barrier is determined by 2 different components: charge-selective small pores that are permeable to molecules with up to a 4-μm radius and large, poorly-defined breaks of the barrier without size or charge selectivity (reviewed in Anderson and Van Itallie83). TEER reflects small-pore permeability, whereas flux of FITC with a reported Stokes' radius of approximately 5.5 Å measures the permeability of large barrier breaks. Knockdown of claudin-1 in PHK monolayers decreased TEER and increased FITC flux, which implicates claudin-1 in regulation of both paracellular pores and breaks in the epidermal barrier. These findings strongly suggest that the skin of patients with AD would also be more permissive to a number of relevant environmental allergens, such as house dust mite. Purified allergens from the house dust mite Dermatophagoides pteronyssinus have a diameter of approximately 1.6 Å, as determined by means of radiographic crystallography, and therefore could penetrate even small paracellular pores formed by epithelial TJs.84 Thus defective expression and function of claudin-1 in patients with AD provides a plausible molecular mechanism for increased sensitization to environmental antigens, allergens, irritants, or pollutants (Fig 1). This is in keeping with the distinction that AD is the allergic disorder with the greatest and most diverse allergen reactivity, as reflected in high serum total IgE values.

AD is also recognized for a reduced cutaneous irritancy threshold that could simply reflect greater epidermal penetration of irritants (Fig 1). Importantly, TJ disruption is a leading hypothesis to explain allergen reactivity in the airways, which manifests as asthma and allergic rhinitis or, in the intestinal tract, as food allergy.3, 85, 86

Although we observed an inverse correlation between claudin-1 expression and markers of TH2 polarity, we did not find that TH2 cytokines (IL-4 and IL-13 alone or together) reduced claudin-1 expression but in fact observed the opposite. This induction of claudin-1 was observed in conjunction with enhanced TJ function (eg, TEER) and suggests that TH2 cytokines have a reparative effect on TJs in normal keratinocytes. Whether the actions of these TH2 cytokines would be different in AD epidermis will require further study. Interestingly, TH2 cytokines have been shown to reduce the expression of several SC components important for skin barrier function.72 At this point, we conclude that TJ dysfunction observed in AD epidermis is not likely caused by TH2 milieu, which is present even at nonlesional sites. Instead, we would hypothesize that the connection we observed between TJ function and biomarkers of TH2 polarity suggest that AD TJ defects enable or promote TH2 responses, possibly by enhancing the trafficking of nonself antigens that are responsible for triggering the TH2 response in genetically predisposed persons. Alternatively, the upregulation of claudin-1 in response to IL-4 and IL-13 might represent a compensatory immune response to “protect” against further antigen uptake through the skin.

In preliminary studies we evaluated genetic associations between CLDN1 polymorphisms and AD. We undertook a haplotype-tagging SNP approach using genetic markers available in the public arena (n = 132 in dbSNP) in 414 EA subjects and 328 AA subjects. Interestingly, CLDN1 is localized on chromosome 3q28-q29, very close to the ATOD1 locus for AD.87 Adjusting for 10,000 permutations to reduce a type I error caused by multiple comparisons, we observed several modest associations (P = .003-.05) between variants throughout the CLDN1 gene and the outcomes associated with AD, especially among AA subjects. In separate studies we tested for associations between several of the same CLDN1 SNPs and risk of disease among a more robustly powered German dataset of patients with AD and control subjects; however, the full set of SNPs genotyped in the ADVN study were not available for direct comparisons, and phenotyping approaches differed (data not shown). Further studies are underway for comprehensive joint analyses between ADVN and the German study. Interestingly, CLDN1 variants were also associated with asthma and its related traits, total serum IgE levels and FEV1, in 2 independent populations of African descent (K. Barnes, unpublished data). In addition, the rs893051 SNP associated with AD severity in our AA population was also associated with asthma and disease severity in a population of African descent. As part of the ADVN study, our population was also screened for the 2 most frequent FLG mutations (R501X and 2282del4, Table I) and 9 haplotype-tagging SNPs throughout the FLG gene.51 There were no significant interaction effects between haplotype-tagging SNPs in FLG and CLDN1 SNPs. Moreover, in the AA population, in which we had the strongest association with CLDN1 SNPs, the 2 FLG mutations were considerably less common than in our EA population.51 Our findings provide suggestive evidence for a role for CLDN1 variants in AD and its associated phenotypes, further supporting the importance of CLDN1 in patients with AD.

In conclusion, this study provides the first evidence that epidermal TJs are defective in patients with AD, the most common human skin disease. We observed that claudin-1 is selectively reduced in the epidermis of patients with AD and that CLDN1 might be a novel AD susceptibility gene. Epidermal samples from patients with AD had remarkable defects in resistance and ion transport compared with those from healthy control subjects. Using the model of human keratinocyte monolayers, we observed enhanced claudin-1 expression and recruitment to intercellular junctions on cell differentiation, which coincided with the development of a paracellular barrier. Selective downregulation of claudin-1 expression markedly increased paracellular permeability, decreased resistance, and enhanced proliferation indicative of a wound repair response. We hypothesize that the reduced expression of claudin-1 in AD epidermis might enhance the penetration of many relevant environmental antigens, leading to greater allergen sensitization, as well as greater susceptibility to irritants/pollutants and possibly even altered microbial flora (Fig 1). The inverse relationship between claudin-1 and serum total IgE values also suggests that this defect might promote TH2 responses. Collectively, these data suggest that barrier dysfunction in patients with AD extends beyond the SC to TJs, the second barrier structure, and that barrier regulation provides a novel therapeutic opportunity in patients with AD and possibly other atopic disorders.

Key messages


Claudin-1 plays a critical role in human epidermal TJ function and keratinocyte proliferation.

Expression of claudin-1 is significantly reduced in nonlesional skin of patients with AD compared with nonatopic subjects and patients with psoriasis.

Claudin-1 levels are inversely correlated with TH2 biomarkers, suggesting that reductions in this key TJ barrier protein might affect the character of the immune response to environmental allergens.

Analysis of CLDN1 haplotype-tagging SNPs in 2 North American populations revealed associations with AD.

Back to Article Outline

 

We thank Mark Slifka, PhD, at Oregon Health & Science University (Beaverton, Ore) for careful review of the manuscript and helpful suggestions; Dr Rasika Mathias for advice on interpretation of SNP findings; Mary Brummet, MS, at the Johns Hopkins Asthma & Allergy Center (Baltimore, Md) and Mary Bolognino, BS, at the University of Rochester Medical Center (Rochester, NY) for facilitating experiments and providing us with PHKs. We also thank several groups whose efforts made the clinical enrollment possible: ADVN Coordinators (Patricia Taylor, NP; Trista Berry, BS; Susan Tofte, FNP; Shahana Baig-Lewis, MPH; Peter Brown, BS; Lisa Heughan, BA, CCRC; Meggie Nguyen, BS; Doru Alexandrescu, MD; Lorianne Stubbs, RC; Reena Vaid MD; and Diana Lee, MD); ADVN regulatory advisors (Judy Lairsmith, RN, and Lisa Leventhal, MSS, CIM, CIP); biological sample tracking (JHU: Tracey Hand, MSc; Jessica Scarpola and Muralidhar Bopparaju, MSc; URMC: Mary Bolognino, MS); National Institute of Allergy and Infectious Diseases–DAIT oversight (Marshall Plaut, MD, and Joy Laurienzo Panza, RN, BSN); DACI Laboratory (Robert Hamilton, PhD); Rho, Inc, statistical support (Daniel Zaccaro, MS, and Brian Armstrong, MPH); Rho, Inc, general study support and oversight (Jamie Reese, BS; Susi Lieff, PhD; and Gloria David, PhD, MHSc); and, last but by no means least, all the patients who participated in this study.

Back to Article Outline

Methods 

Genotyping and quality control 

We performed genotyping on genomic DNA extracted from blood samples using the MagAttract DNA blood Mini M48 kit (Qiagen) on a Biorobot M48, according to the manufacturer's instructions. DNA quantification was performed with Pico-Green (Molecular Probes). Genotyping in these samples was determined for each of the selected tagging SNPs with the Illumina GoldenGate custom panel containing 384-plex assays, according to the manufacturer's protocol.

Tagging SNPs were selected to represent the CLDN1 gene in both the EA and AA groups. The SNP selection approach was to examine 10 kb upstream and 10 kb downstream in accordance with design score validations based on Illumina in-house measurements and the 60-bp limitation (an SNP cannot be closer than 60 bp to another SNP on this OPA). We initially selected all available CLDN1 SNPs from the HapMap (http://www.hapmap.org/) to tag the LD blocks in each of the ethnic groups (EA and AA subjects). Tagging was based on the LDSelect algorithm, with a minor allele frequency of 10% or greater and an r2 threshold of 0.80 (as reported in HapMap) to ensure nearly perfect LD to infer information on all SNPs captured by the tag set. A final selection included 27 SNPs chosen for the Illumina OPA. Of the 27 tagging SNPs selected, 24 qualified as tagging SNPs from both the HapMap CEPH Utah (CEU, with European ancestry) and HapMap Yoruba (YRI, with African ancestry) samples; an additional 3 tagging SNPs (rs6800425, rs1155884, and rs9809713) were genotyped only in the AA subjects. Two LD blocks were observed among the EA group (block 1: rs10212165, rs3954259, and rs9290929 [D′ = 0.982-1.0]; block 2: rs9835663 and rs3732923 [D′ = 0.976]), and 3 LD blocks were observed among the AA group (block 1: rs3954259 and rs9290929 [D′ = 1.0]; block 2: rs893051, rs9839711, and rs9835663 [D′ = 0.957-1.0]; block 3: rs6800425 and rs3774028 [D′ = 1]) by using the criteria of Gabriel et al.E1

The 27 SNPs were genotyped by using the custom-designed Illumina OPA for the BeadXpress Reader System and the GoldenGate Assay with VeraCode Bead technology (San Diego, Calif), according to the manufacturer's protocol.E2 Briefly, the GoldenGate assay uses 3 primers designed for each locus. Two are specific to each allele at the SNP site, and a third hybridizes at a downstream locus from the site. All 3 primers have regions complementary to both genome and universal PCR primer sites. A total of 250 ng of high-quality gDNA was plated and then activated. The activated DNA, paramagnetic particles, assay oligos, and hybridization buffer are combined in a hybridization step to allow DNA to bind to the particles. After hybridization of primers, plates were washed to reduce noise, and allele-specific oligos were extended and ligated to the downstream locus-specific primer. This mix then served as a PCR template with the universal primers P1, P2, and P3. P1 and P2 are Cy3 and Cy5 labeled. After downstream processing, the single-stranded dye-labeled PCR products were hybridized to their complement VeraCode bead type. Plates were then scanned in the BeadXpress Reader for fluorescence and code identification. Scanned data and oligo assignments were uploaded into Illumina's BeadStudio software for downstream genotype cluster analysis. Genotyping quality was high, with an average completion rate of 97.2% to 98.2% for the BeadXpress genotyping.

Back to Article Outline

Fig E1. 

  • View full-size image.
  • Epidermal differentiation complex genes (EDC) are differentially expressed in patients with AD. A, Gene arrays were performed on nonlesional epithelium (blister roofs) from patients with AD with extrinsic disease (n = 5) and nonatopic control subjects (NA; n = 5). Each column represents a single-array experiment on a single epidermal sample. A heat map of EDC genes was generated, where red represents upregulation and green represents downregulation. B, The data are presented with z ratios comparing patients with AD with nonatopic control subjects (NA).

Back to Article Outline

Fig E2. 

  • View full-size image.
  • Claudin-1 silencing does not affect expression of other proteins relevant for barrier function. CLDN1 siRNA (100 nmol/L) resulted in a 50% reduction in claudin-1 expression compared with that seen in control transfected cells (0.5 ± 0.06–fold, ∗∗P = 0.5 × 10−6, n = 5 per group). Connexin-26 expression (GJB2) was significantly upregulated in CLDN1 siRNA transfected PHKs (1.7 ± 0.8–fold, P = .05, n = 6).

Back to Article Outline

Table E1. 

Real-time PCR primers
TargetForwardReverse
GAPDHGAA GGT GAA GGT CGG AGT CGAA GAT GGT GAT GGG ATT TC
CLDN1CGA TGA GGT GCA GAA GAT GACCA GTG AAG AGA GCC TGA CC
CLDN23CTT GCC ATG CAA ACT CTC AATTC TCC TCT TGG CTT CTG GA
OccludinCTG GCC TAC AGG AAT ACA AGCTT GAT GTG TGA CAA TTT GC
ZO1CGG AAA ACA TGC TAC ACA CCCC ATT TAC TGG CTG GTA T
GJB2 (connexin-26)GTT TAA CGC ATT GCC CAG TTGGC CTA CAG GGG TTT CAA AT
PVRL1 (nectin-1)AGC CAT TAA GGA GAA ACG ATTC CCA ATT TCT CTG CTC T
CDH (E-cadherin)CAGAAAGTTTTCCACCAAAGAAATGTGAGCAATTCTGCTT
FLGGAGCTGAAGGAACTTCTGGGATCCATGAAGACATCAACCA

Back to Article Outline

Table E2. 

Modulation of TJ pathway genes (n = 43) in epidermal samples taken from patients with AD compared with healthy nonatopic control subjects
Genez ratioP valueFold change
ACTN12.796.01211.47
ACTN40.798.37421.14
CGN0.063.95321.04
CIP980.712.19861.1
CLDN1−2.419.0013−1.42
CLDN101.620.06411.27
CLDN12−0.798.2518−1.09
CLDN14−1.056.0896−1.13
CLDN150.553.49671.12
CLDN16−0.007.9881−1.02
CLDN18−0.915.2421−1.08
CLDN23−3.155.0062−1.6
CLDN4−0.977.4279−1.07
CLDN6−1.067.1561−1.02
CLDN7−0.298.6320−1.03
CLDN8−1.265.1616−1.26
CRB30.755.35081.14
CSDA−0.426.4062−1.02
CTNNA10.139.87661.02
CTNNB1−0.879.1319−1.1
INADL0.627.33571.12
LLGL2−0.455.4178−1.06
MAGI10.694.20861.12
MLLT40.374.40001.04
MPDZ0.616.15591.06
MPP5−0.136.87461.11
NR3C1−1.299.0178−1.16
Occludin−1.136.0920−1.17
PARD3−0.621.3375−1.06
PPP2CA0.170.79341.03
PRKCA0.523.39591.02
PRKCI0.329.66711.04
RAB130.532.43871.13
SEC6L10.959.22461.19
SEC8L10.494.54821.07
SPTAN1−1.965.0017−1.21
SRC−0.656.1983−1.05
TJP10.304.44651.04
TJP20.700.48881.14
TJP3−0.666.0605−1.07
TJP40.081.8330−1.02
YES10.734.06921.08
ZAK−0.287.66141.05

Back to Article Outline

Table E3. 

CLDN1 polymorphisms and minor allele frequencies
GenedSNP ID (build 129)LocationInter-SNP distance (bp)PositionType of variantMinor allele frequency
CEUYRIEA subjects (n = 156)AA subjects (n = 152)
CLDN1rs67765301914983940C/ADownstream0.4090.1030.3840.431
3q28rs130927001915022543,860A/GDownstream0.0600.0000.0710.007
rs76329151915041421,888C/ADownstream0.5250.1920.3940.224
rs92909271915052101,068A/TDownstream0.8830.9580.1150.056
rs175010101915093484,138C/AIntron0.1580.3170.1470.252
rs3774032191509554206G/AIntron0.1420.0420.2100.059
rs37740281915109661,412T/AIntron0.4150.0340.3320.082
rs68004251915130182,052G/AIntron0.5420.108NA0.168
rs6776378191513220202G/AIntron0.1980.2630.2760.311
rs9869263191513374154G/ACoding exon0.1500.2800.1280.240
rs10513846191513683309G/AIntron0.1580.1080.1360.056
rs68096851915152881,605G/AIntron0.8330.7030.4240.482
rs9866788191515814526A/GIntron0.4830.2080.4900.273
rs9848283191516502688A/GIntron0.4910.0960.4420.194
rs3732923191517403901A/TIntron0.4080.5750.4100.493
rs98356631915194522,049G/AIntron0.2800.2500.2630.263
rs9839711191519713261C/GIntron0.1000.1580.1260.178
rs8930511915222952,582C/GIntron0.4170.4920.4550.535
rs12696600191522901606A/C5′ UTR0.4460.1980.4570.287
rs1155884191523648747A/CPromoter0.5340.458NA0.431
rs16865347191524091443A/GPromoter0.1080.0850.1060.097
rs92909291915264332,342A/GPromoter0.4330.1330.4100.240
rs3954259191527201768G/APromoter0.5330.1670.5130.293
rs10212165191528104903A/GPromoter0.1500.2500.1730.237
rs168653731915295021,398G/APromoter0.0500.0330.0620.051
rs9809713191529746244G/APromoter0.5420.492NA0.496
rs16865378191529856110A/GPromoter0.0500.0000.0450.017

UTR, Untranslated region.

From HapMap (http://www.hapmap.org) for 60 Yoruban (YRI) and 60 Utah EA (CEU) founders.

Minor allele frequencies from healthy control subjects participating in the ADVN study.

Back to Article Outline

Table E4. 

CLDN1 SNP association test results
EA subjectsAA subjects
dbSNP ID (build 129)ADAD at <5 yEASIADAD at <5 yEASI
rs6776530.25.13.61.86.7.28
rs13092700.66.45.42.21.13.37
rs7632915.53.36.54.67.58.1
rs9290927.41.24.44.04 (.039).33.49
rs17501010.46.31.92.003 (.005).04 (.065).91
rs3774032.48.48.7.29.24.9
rs3774028.84.7.13.96.51.25
rs6800425NANA.69.36.36.94
rs6776378.7.52.94.18.12.62
rs9869263.29.44.94.68.69.12
rs10513846.46.2.86.46.65.38
rs6809685.99.93.27.89.46NA
rs9866788.5.74.17.67.75.93
rs9848283.52.29.06.38.61.57
rs3732923.99.99.77.58.82.24
rs9835663.21.29.68.81.38.13
rs9839711.64.75.37.7.08.89
rs893051.73.64.29.57.79.01 (.010)
rs12696600.78.75.53.34.14.22
rs1155884NANA.32.66.29.49
rs16865347.11.16.34.81.33.96
rs9290929.38.42.08.49.64.007 (.006)
rs3954259.94.97.27.31.15.14
rs10212165.52.81.38.76.17.55
rs16865373.03 (.034).03 (.034).52.43.82.2
rs9809713NANA.26.82.2.2
rs16865378.77.89.62.19.28.24

NA, Not applicable.

Unadjusted P value based on Cochran-Armitage trend test.

Empiric P value based on 10,000 permutations.

Back to Article Outline

References 

  1. Laughter D, Istvan JA, Tofte SJ, Hanifin JM. The prevalence of atopic dermatitis in Oregon schoolchildren. J Am Acad Dermatol. 2000;43:649–655
  2. Odhiambo JA, Williams HC, Clayton TO, Robertson CF, Asher MI. Global variations in prevalence of eczema symptoms in children from ISAAC Phase Three. J Allergy Clin Immunol. 2009;124:1251–1258e23
  3. Schulzke JD, Ploeger S, Amasheh M, Fromm A, Zeissig S, Troeger H, et al. Epithelial tight junctions in intestinal inflammation. Ann N Y Acad Sci. 2009;1165:294–300
  4. Holgate ST. Epithelium dysfunction in asthma. J Allergy Clin Immunol. 2007;120:1233–1246
  5. Demehri S, Morimoto M, Holtzman MJ, Kopan R. Skin-derived TSLP triggers progression from epidermal-barrier defects to asthma. PLoS Biol. 2009;7:e1000067
  6. Holgate ST. The epithelium takes centre stage in asthma and atopic dermatitis. Trends Immunol. 2007;28:248–251
  7. Hata M, Tokura Y, Takigawa M, Sato M, Shioya Y, Fujikura Y, et al. Assessment of epidermal barrier function by photoacoustic spectrometry in relation to its importance in the pathogenesis of atopic dermatitis. Lab Invest. 2002;82:1451–1461
  8. Madison KC. Barrier function of the skin: “la raison d′être” of the epidermis. J Invest Dermatol. 2003;121:231–241
  9. Imokawa G. Lipid abnormalities in atopic dermatitis. J Am Acad Dermatol. 2001;45(suppl):S29–S32
  10. Murata Y, Ogata J, Higaki Y, Kawashima M, Yada Y, Higuchi K, et al. Abnormal expression of sphingomyelin acylase in atopic dermatitis: an etiologic factor for ceramide deficiency?. J Invest Dermatol. 1996;106:1242–1249
  11. Pilgram GS, Vissers DC, van der Meulen H, Pavel S, Lavrijsen SP, Bouwstra JA, et al. Aberrant lipid organization in stratum corneum of patients with atopic dermatitis and lamellar ichthyosis. J Invest Dermatol. 2001;117:710–717
  12. Palmer CN, Irvine AD, Terron-Kwiatkowski A, Zhao Y, Liao H, Lee SP, et al. Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis. Nat Genet. 2006;38:441–446
  13. Cork MJ, Robinson DA, Vasilopoulos Y, Ferguson A, Moustafa M, MacGowan A, et al. New perspectives on epidermal barrier dysfunction in atopic dermatitis: gene-environment interactions. J Allergy Clin Immunol. 2006;118:3–23
  14. Howell MD, Kim BE, Gao P, Grant AV, Boguniewicz M, DeBenedetto A, et al. Cytokine modulation of atopic dermatitis filaggrin skin expression. J Allergy Clin Immunol. 2009;124:R7–R12
  15. Vasilopoulos Y, Cork MJ, Teare D, Marinou I, Ward SJ, Duff GW, et al. A nonsynonymous substitution of cystatin A, a cysteine protease inhibitor of house dust mite protease, leads to decreased mRNA stability and shows a significant association with atopic dermatitis. Allergy. 2007;62:514–519
  16. Schluter H, Moll I, Wolburg H, Franke WW. The different structures containing tight junction proteins in epidermal and other stratified epithelial cells, including squamous cell metaplasia. Eur J Cell Biol. 2007;86:645–655
  17. Umeda K, Ikenouchi J, Katahira-Tayama S, Furuse K, Sasaki H, Nakayama M, et al. ZO-1 and ZO-2 independently determine where claudins are polymerized in tight-junction strand formation. Cell. 2006;126:741–754
  18. Niessen CM. Tight junctions/adherens junctions: basic structure and function. J Invest Dermatol. 2007;127:2525–2532
  19. Leyvraz C, Charles RP, Rubera I, Guitard M, Rotman S, Breiden B, et al. The epidermal barrier function is dependent on the serine protease CAP1/Prss8. J Cell Biol. 2005;170:487–496
  20. Tsukita S, Furuse M, Itoh M. Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol. 2001;2:285–293
  21. Tsukita S, Furuse M. Claudin-based barrier in simple and stratified cellular sheets. Curr Opin Cell Biol. 2002;14:531–536
  22. Van Itallie CM, Anderson JM. Claudins and epithelial paracellular transport. Annu Rev Physiol. 2006;68:403–429
  23. Utech M, Bruwer M, Nusrat A. Tight junctions and cell-cell interactions. Methods Mol Biol. 2006;341:185–195
  24. Elias PM, Friend DS. The permeability barrier in mammalian epidermis. J Cell Biol. 1975;65:180–191
  25. Schluter H, Wepf R, Moll I, Franke WW. Sealing the live part of the skin: the integrated meshwork of desmosomes, tight junctions and curvilinear ridge structures in the cells of the uppermost granular layer of the human epidermis. Eur J Cell Biol. 2004;83:655–665
  26. Pummi K, Malminen M, Aho H, Karvonen SL, Peltonen J, Peltonen S. Epidermal tight junctions: ZO-1 and occludin are expressed in mature, developing, and affected skin and in vitro differentiating keratinocytes. J Invest Dermatol. 2001;117:1050–1058
  27. Furuse M, Hata M, Furuse K, Yoshida Y, Haratake A, Sugitani Y, et al. Claudin-based tight junctions are crucial for the mammalian epidermal barrier: a lesson from claudin-1-deficient mice. J Cell Biol. 2002;156:1099–1111
  28. Werner Y, Lindberg M. Transepidermal water loss in dry and clinically normal skin in patients with atopic dermatitis. Acta Derm Venereol. 1985;65:102–105
  29. Hon KL, Wong KY, Leung TF, Chow CM, Ng PC. Comparison of skin hydration evaluation sites and correlations among skin hydration, transepidermal water loss, SCORAD index, Nottingham Eczema Severity Score, and quality of life in patients with atopic dermatitis. Am J Clin Dermatol. 2008;9:45–50
  30. Nemoto-Hasebe I, Akiyama M, Nomura T, Sandilands A, McLean WH, Shimizu H. Clinical severity correlates with impaired barrier in filaggrin-related eczema. J Invest Dermatol. 2009;129:682–689
  31. Fallon PG, Sasaki T, Sandilands A, Campbell LE, Saunders SP, Mangan NE, et al. A homozygous frameshift mutation in the mouse Flg gene facilitates enhanced percutaneous allergen priming. Nat Genet. 2009;41:602–608
  32. Kubo A, Nagao K, Yokouchi M, Sasaki H, Amagai M. External antigen uptake by Langerhans cells with reorganization of epidermal tight junction barriers. J Exp Med. 2009;206:2937–2946
  33. Klechevsky E, Morita R, Liu M, Cao Y, Coquery S, Thompson-Snipes L, et al. Functional specializations of human epidermal Langerhans cells and CD14+ dermal dendritic cells. Immunity. 2008;29:497–510
  34. Motta S, Monti M, Sesana S, Mellesi L, Ghidoni R, Caputo R. Abnormality of water barrier function in psoriasis. Role of ceramide fractions. Arch Dermatol. 1994;130:452–456
  35. de Cid R, Riveira-Munoz E, Zeeuwen PL, Robarge J, Liao W, Dannhauser EN, et al. Deletion of the late cornified envelope LCE3B and LCE3C genes as a susceptibility factor for psoriasis. Nat Genet. 2009;41:211–215
  36. Eichenfield LF. Consensus guidelines in diagnosis and treatment of atopic dermatitis. Allergy. 2004;59(suppl 78):86–92
  37. Cheadle C, Cho-Chung YS, Becker KG, Vawter MP. Application of z-score transformation to Affymetrix data. Appl Bioinformatics. 2003;2:209–217
  38. Nadon R, Shoemaker J. Statistical issues with microarrays: processing and analysis. Trends Genet. 2002;18:265–271
  39. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods. 2001;25:402–408
  40. Beck LA, Stellato C, Beall LD, Schall TJ, Leopold D, Bickel CA, et al. Detection of the chemokine RANTES and endothelial adhesion molecules in nasal polyps. J Allergy Clin Immunol. 1996;98:766–780
  41. Berry CA, Warnock DG, Rector FC. Ion selectivity and proximal salt reabsorption. Am J Physiol. 1978;235:F234–F245
  42. Vidyasagar S, Ramakrishna BS. Effects of butyrate on active sodium and chloride transport in rat and rabbit distal colon. J Physiol. 2002;539:163–173
  43. Hallani M, Lynch JW, Barry PH. Characterization of calcium-activated chloride channels in patches excised from the dendritic knob of mammalian olfactory receptor neurons. J Membr Biol. 1998;161:163–171
  44. Poumay Y, Roland IH, Leclercq-Smekens M, Leloup R. Basal detachment of the epidermis using dispase: tissue spatial organization and fate of integrin alpha 6 beta 4 and hemidesmosomes. J Invest Dermatol. 1994;102:111–117
  45. Beck LA, Boguniewicz M, Hata T, Schneider LC, Hanifin J, Gallo R, et al. Phenotype of atopic dermatitis subjects with a history of eczema herpeticum. J Allergy Clin Immunol. 2009;124:260–269e1-7
  46. Hanifin JM, Thurston M, Omoto M, Cherill R, Tofte SJ, Graeber M. The eczema area and severity index (EASI): assessment of reliability in atopic dermatitis. EASI Evaluator Group. Exp Dermatol. 2001;10:11–18
  47. Carlson CS, Eberle MA, Rieder MJ, Yi Q, Kruglyak L, Nickerson DA. Selecting a maximally informative set of single-nucleotide polymorphisms for association analyses using linkage disequilibrium. Am J Hum Genet. 2004;74:106–120
  48. Howie BN, Carlson CS, Rieder MJ, Nickerson DA. Efficient selection of tagging single-nucleotide polymorphisms in multiple populations. Hum Genet. 2006;120:58–68
  49. Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, et al. The structure of haplotype blocks in the human genome. Science. 2002;296:2225–2229
  50. Fan JB, Gunderson KL, Bibikova M, Yeakley JM, Chen J, Wickham Garcia E, et al. Illumina universal bead arrays. Methods Enzymol. 2006;410:57–73
  51. Gao PS, Rafaels NM, Hand T, Murray T, Boguniewicz M, Hata T, et al. Filaggrin mutations that confer risk of atopic dermatitis confer greater risk for eczema herpeticum. J Allergy Clin Immunol. 2009;124:507–513e1-7
  52. Sugiura H, Ebise H, Tazawa T, Tanaka K, Sugiura Y, Uehara M, et al. Large-scale DNA microarray analysis of atopic skin lesions shows overexpression of an epidermal differentiation gene cluster in the alternative pathway and lack of protective gene expression in the cornified envelope. Br J Dermatol. 2005;152:146–149
  53. Guttman-Yassky E, Suarez-Farinas M, Chiricozzi A, Nograles KE, Shemer A, Fuentes-Duculan J, et al. Broad defects in epidermal cornification in atopic dermatitis identified through genomic analysis. J Allergy Clin Immunol. 2009;124:1235–1244e58
  54. Brandner JM. Tight junctions and tight junction proteins in mammalian epidermis. Eur J Pharm Biopharm. 2009;72:289–294
  55. Brandner JM, Kief S, Grund C, Rendl M, Houdek P, Kuhn C, et al. Organization and formation of the tight junction system in human epidermis and cultured keratinocytes. Eur J Cell Biol. 2002;81:253–263
  56. Watson RE, Poddar R, Walker JM, McGuill I, Hoare LM, Griffiths CE, et al. Altered claudin expression is a feature of chronic plaque psoriasis. J Pathol. 2007;212:450–458
  57. Langbein L, Grund C, Kuhn C, Praetzel S, Kartenbeck J, Brandner JM, et al. Tight junctions and compositionally related junctional structures in mammalian stratified epithelia and cell cultures derived therefrom. Eur J Cell Biol. 2002;81:419–435
  58. Madara JL. Regulation of the movement of solutes across tight junctions. Annu Rev Physiol. 1998;60:143–159
  59. Schmitz H, Barmeyer C, Fromm M, Runkel N, Foss HD, Bentzel CJ, et al. Altered tight junction structure contributes to the impaired epithelial barrier function in ulcerative colitis. Gastroenterology. 1999;116:301–309
  60. Ussing HH, Zerahn K. Active transport of sodium as the source of electric current in the short-circuited isolated frog skin. Acta Physiol Scand. 1951;23:110–127
  61. van de Kerkhof EG, de Graaf IA, Groothuis GM. In vitro methods to study intestinal drug metabolism. Curr Drug Metab. 2007;8:658–675
  62. Wang W, Uzzau S, Goldblum SE, Fasano A. Human zonulin, a potential modulator of intestinal tight junctions. J Cell Sci. 2000;113(Pt 24):4435–4440
  63. Yamamoto T, Saeki Y, Kurasawa M, Kuroda S, Arase S, Sasaki H. Effect of RNA interference of tight junction-related molecules on intercellular barrier function in cultured human keratinocytes. Arch Dermatol Res. 2008;300:517–524
  64. Yamamoto T, Kurasawa M, Hattori T, Maeda T, Nakano H, Sasaki H. Relationship between expression of tight junction-related molecules and perturbed epidermal barrier function in UVB-irradiated hairless mice. Arch Dermatol Res. 2008;300:61–68
  65. Tsukita S, Yamazaki Y, Katsuno T, Tamura A, Tsukita S. Tight junction-based epithelial microenvironment and cell proliferation. Oncogene. 2008;27:6930–6938
  66. Lopardo T, Lo Iacono N, Marinari B, Giustizieri ML, Cyr DG, Merlo G, et al. Claudin-1 is a p63 target gene with a crucial role in epithelial development. PLoS One. 2008;3:e2715
  67. Kurasawa M, Kuroda S, Kida N, Murata M, Oba A, Yamamoto T, et al. Regulation of tight junction permeability by sodium caprate in human keratinocytes and reconstructed epidermis. Biochem Biophys Res Commun. 2009;381:171–175
  68. Kinugasa T, Sakaguchi T, Gu X, Reinecker HC. Claudins regulate the intestinal barrier in response to immune mediators. Gastroenterology. 2000;118:1001–1011
  69. Tedelind S, Ericson LE, Karlsson JO, Nilsson M. Interferon-gamma down-regulates claudin-1 and impairs the epithelial barrier function in primary cultured human thyrocytes. Eur J Endocrinol. 2003;149:215–221
  70. Singh AB, Harris RC. Epidermal growth factor receptor activation differentially regulates claudin expression and enhances transepithelial resistance in Madin-Darby canine kidney cells. J Biol Chem. 2004;279:3543–3552
  71. Kurahashi R, Hatano Y, Katagiri K. IL-4 suppresses the recovery of cutaneous permeability barrier functions in vivo. J Invest Dermatol. 2008;128:1329–1331
  72. Sehra S, Yao Y, Howell MD, Nguyen ET, Kansas GS, Leung DY, et al. IL-4 regulates skin homeostasis and the predisposition toward allergic skin inflammation. J Immunol. 2010;184:3186–3190
  73. Hamid Q, Boguniewicz M, Leung DY. Differential in situ cytokine gene expression in acute versus chronic atopic dermatitis. J Clin Invest. 1994;94:870–876
  74. Peltonen S, Riehokainen J, Pummi K, Peltonen J. Tight junction components occludin, ZO-1, and claudin-1, -4 and -5 in active and healing psoriasis. Br J Dermatol. 2007;156:466–472
  75. Kirschner N, Poetzl C, von den Driesch P, Wladykowski E, Moll I, Behne MJ, et al. Alteration of tight junction proteins is an early event in psoriasis: putative involvement of proinflammatory cytokines. Am J Pathol. 2009;175:1095–1106
  76. Itoh K, Kawasaki S, Kawamoto S, Seishima M, Chiba H, Michibata H, et al. Identification of differentially expressed genes in psoriasis using expression profiling approaches. Exp Dermatol. 2005;14:667–674
  77. Troy TC, Arabzadeh A, Lariviere NM, Enikanolaiye A, Turksen K. Dermatitis and aging-related barrier dysfunction in transgenic mice overexpressing an epidermal-targeted claudin 6 tail deletion mutant. PLoS One. 2009;4:e7814
  78. Hadj-Rabia S, Baala L, Vabres P, Hamel-Teillac D, Jacquemin E, Fabre M, et al. Claudin-1 gene mutations in neonatal sclerosing cholangitis associated with ichthyosis: a tight junction disease. Gastroenterology. 2004;127:1386–1390
  79. Feldmeyer L, Huber M, Fellmann F, Beckmann JS, Frenk E, Hohl D. Confirmation of the origin of NISCH syndrome. Hum Mutat. 2006;27:408–410
  80. Zimmerli SC, Kerl K, Hadj-Rabia S, Hohl D, Hauser C. Human epidermal Langerhans cells express the tight junction protein claudin-1 and are present in human genetic claudin-1 deficiency (NISCH syndrome). Exp Dermatol. 2008;17:20–23
  81. Yuki T, Haratake A, Koishikawa H, Morita K, Miyachi Y, Inoue S. Tight junction proteins in keratinocytes: localization and contribution to barrier function. Exp Dermatol. 2007;16:324–330
  82. Tebbe B, Mankertz J, Schwarz C, Amasheh S, Fromm M, Assaf C, et al. Tight junction proteins: a novel class of integral membrane proteins. Expression in human epidermis and in HaCaT keratinocytes. Arch Dermatol Res. 2002;294:14–18
  83. Anderson JM, Van Itallie CM. Physiology and function of the tight junction. Cold Spring Harbor Perspect Biol. 2009;1:a002584
  84. Meno K, Thorsted PB, Ipsen H, Kristensen O, Larsen JN, Spangfort MD, et al. The crystal structure of recombinant proDer p 1, a major house dust mite proteolytic allergen. J Immunol. 2005;175:3835–3845
  85. Runswick S, Mitchell T, Davies P, Robinson C, Garrod DR. Pollen proteolytic enzymes degrade tight junctions. Respirology. 2007;12:834–842
  86. Groschwitz KR, Hogan SP. Intestinal barrier function: molecular regulation and disease pathogenesis. J Allergy Clin Immunol. 2009;124:3–22
  87. Morar N, Willis-Owen SA, Moffatt MF, Cookson WO. The genetics of atopic dermatitis. J Allergy Clin Immunol. 2006;118:24–36

Back to Article Outline

References 

  1. Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, et al. The structure of haplotype blocks in the human genome. Science. 2002;296:2225–2229
  2. Fan JB, Gunderson KL, Bibikova M, Yeakley JM, Chen J, Wickham Garcia E, et al. Illumina universal bead arrays. Methods Enzymol. 2006;410:57–73

 Supported by the Atopic Dermatitis and Vaccinia Network NIH/NIAID (contract N01 AI40029 and N01 AI40033), the National Eczema Association (A.D., L.A.B.), and the Mary Beryl Patch Turnbull Scholar Program (K.C.B.).

 Disclosure of potential conflict of interest: A. De Benedetto has received research support from the National Eczema Association and the National Institutes of Health (NIH)/National Institute of Allergy and Infectious Diseases (NIAID). N. M. Rafaels has received research support from the NIH/NIAID. C. Cheadle has received research support from the NIH/NIAID. T. Yoshida has received research support from the NIH/NIAID. M. Boguniewicz has received research support from the NIH/NIAID. J. M. Hata has received research support from the NIH/NIAID. L. C. Schneider has received research support from Astellas and Novartis. J. M. Hanifin has received consulting fees from Johnson & Johnson and Otsuka Pharmaceutical Co and has received research support from Astellas Pharma US, Basilea, Novartis, Shionogi USA, the NIH/NIAID, and Taisho. R. L. Gallo has received research support from the NIH/NIAID. N. Novak has received research support from the German Research Council and the NIH/NIAID. T. H. Beaty has received research support from the NIH/NIAID. D. Y. M. Leung has received research support from the NIH/NIAID. K. C. Barnes has received research support from the NIH and Sanofi-Aventis. L. A. Beck has consulted for Regeneron, has received research support from the NIH/NIAID and the National Eczema Association. The rest of the authors have declared that they have no conflict of interest.

PII: S0091-6749(10)01632-5

doi:10.1016/j.jaci.2010.10.018

The Journal of Allergy and Clinical Immunology
Volume 127, Issue 3 , Pages 773-786.e7, March 2011