The Journal of Allergy and Clinical Immunology
Volume 126, Issue 2 , Pages 366-374.e8, August 2010

IL-13 and TH2 cytokine exposure triggers matrix metalloproteinase 7–mediated Fas ligand cleavage from bronchial epithelial cells

  • Samuel J. Wadsworth, PhD

      Affiliations

    • UBC James Hogg Research Laboratories, Providence Heart and Lung Institute, University of British Columbia, Vancouver, British Columbia, Canada
    • Corresponding Author InformationReprint requests: Samuel J. Wadsworth, PhD, UBC James Hogg Research Laboratories, Providence Heart + Lung Institute, St Paul's Hospital, Room 166, 1081 Burrard St, Vancouver, British Columbia V6Z 1Y6, Canada.
    • ,
  • Ryo Atsuta, MD, PhD

      Affiliations

    • Department of Respiratory Medicine, Juntendo University School of Medicine, Tokyo, Japan
    • ,
  • J. Oliver McIntyre, PhD

      Affiliations

    • Department of Cancer Biology and Vanderbilt-Ingram Cancer Center, Vanderbilt University Medical Center, Nashville, Tenn
    • ,
  • Tillie-Louise Hackett, PhD

      Affiliations

    • UBC James Hogg Research Laboratories, Providence Heart and Lung Institute, University of British Columbia, Vancouver, British Columbia, Canada
    • ,
  • Gurpreet K. Singhera, PhD

      Affiliations

    • UBC James Hogg Research Laboratories, Providence Heart and Lung Institute, University of British Columbia, Vancouver, British Columbia, Canada
    • ,
  • Delbert R. Dorscheid, MD, PhD

      Affiliations

    • UBC James Hogg Research Laboratories, Providence Heart and Lung Institute, University of British Columbia, Vancouver, British Columbia, Canada

Received 24 September 2009; received in revised form 30 March 2010; accepted 11 May 2010. published online 12 July 2010.

Article Outline

Background

Bronchial epithelial damage and activation likely contribute to the inflammatory and airway-remodeling events characteristic of severe asthma. Interaction of Fas receptor (CD95) with its ligand (FasL; CD95L) is an important mechanism of cell-mediated apoptosis. Bronchial epithelial FasL expression provides immune barrier protection from immune cell–mediated damage.

Objectives

Membrane FasL (mFasL) is a cleavage target of matrix metalloproteinases (MMPs). We investigated whether the asthmatic TH2 environment might influence disease processes by increasing airway epithelial MMP-mediated cleavage of mFasL into proinflammatory soluble FasL.

Methods

We used human airway epithelial cell lines and primary cells to model the human airway epithelium in vitro. Airway tissue from healthy subjects and patients with severe asthma was used to investigate MMP expression patterns in diseased airways.

Results

We demonstrate that active MMP-7 is present in the ciliated epithelial cells of normal human airways. In patients with severe asthma, MMP-7 levels are increased in basal epithelial cells. Airway epithelial cell lines (1HAEo− and 16HBE14o−) in vitro express constitutively high levels of MMP-2 and MMP-9 but relatively low levels of MMP-7. TH2 cytokine (IL-4, IL-9, and IL-13) treatment of 1HAEo− cells increased MMP-7 mRNA and activity, triggered colocalization of intracellular MMP-7 with FasL, and caused mFasL cleavage with soluble FasL release. Small interfering RNA knockdown shows that cytokine-induced mFasL cleavage is dependent on MMP-7 activity.

Conclusions

MMPs serve multiple beneficial roles in the lung. However, chronic disordered epithelial expression of MMP-7 in patients with asthma might increase mFasL cleavage and contribute to airway epithelial damage and inflammation.

Key words: Asthma, airway epithelial cells, immune barrier, TH2 cytokines, Fas ligand, matrix metalloproteinase 3, matrix metalloproteinase 7, inflammation

Abbreviations used: ADAM, A disintegrin and metalloproteinase, AEC, Airway epithelial cell, DAPI, 4′,6-Diamidino-2-phenylindole, ECM, Extracellular matrix, FasL, Fas ligand, FITC, Fluorescein isothiocyanate, FKHR, Forkhead, HB-EGF, Heparin-binding EGF, HBEC, Human bronchial epithelial cell, HPRT, Hypoxanthine phosphoribosyltransferase, ISZ, In situ zymography, mFasL, Membrane Fas ligand, MMP, Matrix metalloproteinase, rhMMP-7, Recombinant human active MMP-7, rp, Pearson correlation of colocalization, sFasL, Soluble Fas ligand, siRNA, Small interfering RNA, TBS, Tris-buffered saline, TIMP, Tissue inhibitor of metalloproteinases, TRITC, Tetramethylrhodamine isothiocyanate

 

Asthma is a disease of increasing prevalence, but the cause remains elusive. The immune response in patients with asthma is skewed toward a TH2-type response,1 and TH2 cytokines, including IL-4, IL-9, and IL-13, are thought to play crucial roles in the development of chronic airway inflammation and structural remodeling events.2, 3 The airway epithelium is the interface between inspired air and the internal milieu, providing a physical barrier against inhaled allergens, pathogens, and other noxious airborne substances. In pathological studies epithelial damage and shedding are cardinal features of chronic airway remodeling in patients with asthma and correlate with disease severity and airway hyperreactivity.4, 5, 6, 7, 8 It is currently unknown how epithelial damage contributes to airway remodeling, although several studies suggest a link between activation of an epithelial “repair” phenotype in asthma and the development of other structural changes in the airway.9, 10, 11

Studies have suggested that the interaction between Fas (CD95) and Fas ligand (FasL; CD95L) regulates remodeling in nonlymphoid tissues and airway epithelial cells (AECs) in patients with cystic fibrosis.12 Fas is an ubiquitously expressed apoptosis-inducing receptor, and FasL is expressed on immune cells, including eosinophils, polymorphic neutrophils, and dendritic cells. Fas ligation by FasL leads to apoptosis of the Fas-presenting cell through trimerization of Fas and subsequent caspase activation. FasL is also expressed in several nonimmune tissues, such as the anterior chamber of the eye, testis, and brain, and confers “immune privilege” by protecting structural cells against immune cell–mediated cell death.13 The human airway epithelium has also been shown to express FasL and thus might function as an “immune barrier” in the airway.14 Airway epithelial FasL levels are increased in patients with severe asthma after steroid treatment, although it is possible that this increase in FasL levels reflects a more severe stage of disease.15 Cell-surface membrane FasL (mFasL) can be cleaved into soluble FasL (sFasL), which cannot trigger Fas trimerization and apoptosis and instead functions as a proinflammatory chemokine for polymorphonuclear neutrophils.16, 17, 18

The balance between the 2 biological forms of FasL is thought to be regulated by the matrix metalloproteinase (MMP) family of Zn2+- and Ca2+-dependent endopeptidases. Each MMP family member is capable of cleaving a variety of extracellular matrix (ECM) and non-ECM substrates (reviewed in Chakraborti et al19), and the cleavage of mFasL into sFasL is MMP dependent.20 Shedding of sFasL from human FasL-expressing cells can be regulated by MMP-3 (stromelysin 1) expression, and MMP-3 activity correlates with sFasL levels in the synovial fluid of patients with rheumatoid arthritis.21 MMP-7 (matrilysin) can also cleave recombinant mFasL from the cell surface of transfected cell lines22, 23 and is associated with inflammation in interstitial lung diseases, including idiopathic pulmonary fibrosis.24 MMPs probably play essential roles in human airway defense and repair; for example, in wounded airway epithelium MMP-7 is found on the basal aspect of flattened migrating cells,25 and murine knockout experiments show that MMP-7 is vital for tracheal epithelial repair.26

Acute inflammation is a necessary process during wound repair, yet prolonged inflammation can lead to further tissue damage. Release of sFasL from the epithelium by means of MMP cleavage might trigger inflammation and contribute to immune cell–mediated epithelial injury through loss of mFasL-mediated immune privilege. As potential regulators of sFasL release, MMP-3 and MMP-7 might therefore contribute to the pathogenic changes observed in patients with asthma.

This study investigates the hypothesis that the TH2 cytokine environment in the airways of asthmatic patients causes aberrant expression of epithelial MMPs. Furthermore, dysregulated MMP activity is responsible for cleaving mFasL from the epithelial surface, downregulating the epithelial immune barrier, and releasing proinflammatory sFasL.

Back to Article Outline

Methods 

Primary human tissue and cell culture 

Lungs from asthmatic patients and lungs from age-matched control subjects were obtained from collaboration between the International Institute for the Advancement of Medicine (Jessup, Pa) network and the iCAPTURE Centre (ethics approval H00-50100). Lung tissue was dissected for fixation or cell isolation (by T.-L. H.). Primary human bronchial epithelial cells (HBECs) isolated from tissue explants or purchased from a commercial source (Lonza, Walkersville, Md) were grown in bronchial epithelial growth media (Lonza). The 1HAEo− and 16HBE14o− SV40-transformed human AEC lines27, 28 were cultured as described previously.29 For experiments, cells were incubated with IL-4 (2 ng/mL), IL-9 (2 ng/mL), and IL-13 (10 ng/mL), alone and in combination, or with recombinant human active MMP-7 (rhMMP-7; Calbiochem, San Diego, Calif).

MMP-7 immunohistochemistry and fluorescent in situ zymography 

MMP-7 immunohistochemistry was performed according to a standard protocol by using a murine monoclonal anti–MMP-7 antibody (ID-2, 1:50, Calbiochem). Numbers of MMP-7+ apical and basal cells were calculated by observer-blinded manual point counting and expressed per millimeter of basement membrane length (Image-Pro Plus; Media Cybernetics, Bethesda, Md). Fluorescent in situ zymography (ISZ) was performed on OCT frozen airway sections by using 1 μmol/L PB-M7VIS (courtesy of J. O. M.), a substrate with a relatively high rate of cleavage by MMP-7.30 Fluorescein isothiocyanate (FITC; sensor), tetramethylrhodamine isothiocyanate (TRITC; reference), and 4′,6-diamidino-2-phenylindole (DAPI) images were captured by using wide-field fluorescence microscopy (Eclipse TE300; Nikon, Tokyo, Japan), and quantified with ImageJ software (National Institutes of Health), and the epithelial FITC/TRITC ratio was calculated. Reaction kinetics were simultaneously measured in 96-well format; PB-M7VIS substrate was incubated with rhMMP-7 (1,000 ng/mL, Calbiochem), and FITC and TRITC signals were measured with a plate reader (Genios; Tecan, Mannedorf, Switzerland).

Quantitative real-time PCR 

Quantitative real-time PCR for MMPs/tissue inhibitors of metalloproteinases (TIMPs) and FasL was performed by using standard techniques with custom-made primers (Oligo [Molecular Biology Insights, Cascade, Colo] and Primer Express [Applied Biosystems, Foster City, Calif]). Primer sequences (see Table E1 in this article's Online Repository at www.jacionline.org), and specific reaction conditions are listed in the Methods section of this article's Online Repository at www.jacionline.org. Results are expressed as fold expression relative to untreated cells, normalized to β-actin (for MMPs/TIMPs) or hypoxanthine phosphoribosyltransferase (HPRT; for FasL) housekeeping controls.

Western blot analysis 

Cell protein extracts and media supernatants were used for Western blot analysis, according to standard techniques,29 with anti–MMP-7 (ID2, 1:200, Calbiochem) or anti–MMP-3 (Ab-2, 1:500; Medicorp, Montreal, Quebec, Canada) antibodies.

Gel zymogram MMP assay 

Media supernatant from cultured cells was centrifuged to remove dead cells, and MMP activity was measured by using casein-gel zymography. If required, samples were concentrated by means of centrifugation at 10,000 rpm at 4°C with 4K Nanosep concentration tubes (Pall, Port Washington, NY). Supernatant MMP-3 and MMP-7 activity was analyzed by using ready-made casein gels (Invitrogen, Carlsbad, Calif), according to standard protocols (see the Methods section in this article's Online Repository), and quantified by means of densitometric imaging of proteolytic bands (ImageJ software).

sFasL ELISA 

sFasL protein concentrations were measured in supernatants by using Maxisorp ELISA plates (Fisher, Ontario, Canada) and a sFasL sandwich ELISA kit (Bender Medsystems, Burlingame, Conn), according to the manufacturer's instructions.

mFasL FACS assay 

After experimental treatments, 1HAEo− cells were washed (PBS) and enzymatically dissociated (0.25% trypsin EDTA, Invitrogen). Cells were labeled with 1 μg of FITC-labeled rat anti-mFasL antibody (H11, Bender Medsystems) or unconjugated murine anti-mFasL antibody (BMS199/2, 1:100, Bender Medsystems) with an Alexa-488 anti-mouse secondary antibody (Molecular Probes, Eugene, Ore). Isotype controls were FITC-conjugated rat IgG2a κ (Biosource International, Camarillo, Calif) and unconjugated murine IgG (MCA928, 1:50; Serotec, Raleigh, NC). Cells were analyzed with an EPICS XL FACS machine (Beckman Coulter, Fullerton, Calif) with appropriate software (Summit V4.3, Dako, Glostrup, Denmark).

Fluorescent confocal microscopy 

1HAEo− cells grown in 8-chamber glass slides were treated with IL-4, IL-9, and IL-13 in combination. Cells were dual labeled with polyclonal rabbit anti-FasL (SC-834, 1:50; Santa Cruz Biotechnology, Santa Cruz, Calif) and monoclonal murine anti–MMP-7 (ID-2, 1:200, Calbiochem) primary antibodies (or isotype controls) and imaged with laser-scanning confocal microscopy.29 Detailed methods are presented in the Methods section of this article's Online Repository. Three-dimensional stacks of 3 to 7 random fields were captured for each experimental condition, with 4 to 10 cells per field. Three-dimensional MMP-7/FasL colocalization was quantified in individual cells by using Volocity software (Improvision, Coventry, United Kingdom) to calculate the Pearson correlation of colocalization (rp; rp of 0-0.5, random colocalization; rp of 0.5-1.0, specific interaction [within approximately 100 nm3 voxels]).31

Small interfering RNA–targeted knockdown of MMP-7 

1HAEo− cells were transfected with a pool of 4 individual MMP7–specific small interfering RNA (siRNA) sequences (ON-TARGETplus SMARTpool; Dharmacon, Lafayette, Colo) by using standard lipid transfection protocols (see the Methods section in this article's Online Repository).

Statistical analysis 

Statistical analyses were performed with PRISM software (GraphPad Software, Inc, San Diego, Calif). Graphic data are expressed as means ± SDs. Means were compared with Student t tests or, for multiple comparisons, 1-way ANOVA with appropriate post hoc tests. Significance is noted at a P value of less than .05.

Back to Article Outline

Results 

MMP-7 protein expression is abnormal in asthmatic airway epithelium 

Representative images demonstrate that healthy subjects have a well-differentiated airway epithelium (Fig 1, A and C), with basal cells, parabasal cells, and apical cells, including ciliated cells and mucus-producing goblet cells. In contrast, the epithelium from asthmatic airways was often poorly differentiated and devoid of ciliated apical cells (Fig 1, B and D). MMP-7 is strongly expressed in ciliated cells of normal epithelium, particularly adjacent to the luminal surface (Fig 1, A). In asthmatic patients MMP-7 expression was found throughout the epithelium, including basal cells (Fig 1, B). The proportion of MMP-7+ apical epithelial cells was significantly lower in the airways of patients with severe asthma (30.3 ± 11.5 cells/mm) compared with those seen in healthy subjects (41.5 ± 11.5 cells/mm; Fig 1, E). In contrast, the number of MMP-7+ basal epithelial cells was significantly higher in asthmatic patients (22.4 ± 13.2 cells/mm) compared with that seen in healthy subjects (11.7 ± 9.3 cells/mm). Total apical and basal cell counts were similar in both groups.

  • View full-size image.
  • Fig 1. 

    MMP-7 expression in normal (A and C) and asthmatic (B and D) airway epithelial tissue. Fig 1, A, In healthy subjects MMP-7 (pink) is present in ciliated cells (arrows). Fig 1, B, Patients with severe asthma express MMP-7 throughout the epithelium, including basal cells (arrows). Fig 1, C and D, Isotype controls for normal and asthmatic tissue, respectively. E, Cell-specific MMP-7 positivity per millimeter of basement membrane. ∗∗P < .01 and ∗∗∗P < .001, ANOVA (n = 5). NS, Not significant. F, ISZ with PB-M7VIS showing a cleaved FITC signal (arrows, goblet cells). Scale bars = 25 μm.

ISZ indicates MMP-7 activity in normal human airway epithelium 

Airway tissue incubated with MMP-7–selective PB-M7VIS substrate exhibits a strong FITC cleavage signal in the apical region of ciliated epithelial cells (Fig 1, F), which is absent from mucus-producing goblet cells, reflecting the immunohistochemical MMP-7 staining pattern in normal airways. Data in the Online Repository show DAPI- and hematoxylin and eosin–stained sections from frozen airway tissue from a nonasthmatic subject (see Fig E1, A and B, in this article's Online Repository at www.jacionline.org). FITC and TRITC images obtained by means of fluorescent ISZ with PB-M7VIS are shown for serial sections (see Fig E1, C and D). Quantification of epithelial fluorescence shows a rapid increase in FITC/TRITC ratio, peaking at 2 hours of incubation, demonstrating MMP activity in airway epithelium (see Fig E1, E). Control sections incubated without PB-M7VIS substrate or without divalent enzymatic cofactors show no significant change in FITC/TRITC ratio over time (data not shown). Incubation of PB-M7VIS substrate with recombinant active MMP-7 (1,000 ng/mL) alone shows similar reaction kinetics to ISZ tissue slices (see Fig E1, F).

MMP expression in AECs 

The constitutive expression of MMP-2, MMP-3, MMP-7, MMP-9, TIMP-1, TIMP-2, a disintegrin and metalloproteinase (ADAM) 10, and ADAM-17 mRNA in the 1HAEo− bronchial epithelial cell line was measured (see Table E2 in this article's Online Repository at www.jacionline.org). MMP-3 and MMP-7 are constitutively expressed at lower levels than gelatinases MMP-2 and MMP-9 and the biological MMP inhibitors TIMP-1 and TIMP-2.

MMP-3 and MMP-7 mRNA expression and activity are increased by TH2 cytokine treatment 

1HAEo− cells treated with IL-4, IL-9, and IL-13 individually and in combination show increased expression of MMP-3 and MMP-7 mRNA (Fig 2, A and B). MMP-3 mRNA is significantly upregulated at 4 hours by IL-13 treatment (Fig 2, A). MMP-7 mRNA was upregulated at 4 hours by IL-13 alone or in combination with IL-4 or IL-9 (Fig 2, B). Neither IL-4 nor IL-9 alone induced a significant change in MMP-7 expression.

  • View full-size image.
  • Fig 2. 

    TH2 cytokines increase MMP-3/MMP-7 expression and activity in 1HAEo− cells. A and B, MMP-3 (Fig 2, A) and MMP-7 (Fig 2, B) mRNA expression levels measured by means of real-time PCR (n = 7). C and D, MMP-3 (Fig 2, C) and MMP-7 (Fig 2, D) activity in cell supernatants measured by means of casein zymography (n = 4-5). ∗∗P < .01 and ∗P < .05 versus untreated control, ANOVA.

Proteinase activities of MMP-3 and MMP-7 were quantified by means of casein zymography (Fig 2, C and D). A significant increase in MMP-3 activity was observed at 2 and 4 hours after IL-9 plus IL-13 treatment and 4 hours after IL-4 plus IL-13 treatment (Fig 2, C). TH2 cytokines also increased MMP-7 activity (Fig 2, D); IL-13 in combination with IL-9 caused a significant increase in activity at 4 hours.

TH2 cytokines trigger a transient increase in AEC mFasL presentation with release of sFasL 

MMP-3, MMP-7, or both potentially cleave mFasL, causing release of sFasL from AECs. Supernatants of 1HAEo− cells contain active MMP-3 and both pro and active forms of MMP-7, whereas 16HBE14o− cells release only active MMP-3 (Fig 3, A). Previous experiments demonstrate that combinations of cytokines stimulate MMP synthesis and activity to a greater extent than individual cytokines. Subsequent experiments therefore used the combination of TH2 cytokines to mimic the TH2 environment in patients with asthma and to stimulate MMP activity. 1HAEo− cells treated with IL-4, IL-9, and IL-13 in combination release increased sFasL by means of ELISA at 8 hours compared with untreated control cells (Fig 3, B). In contrast, cytokine-treated 16HBE14o− cells show no detectable release of sFasL compared with that seen in control cells (data not shown).

  • View full-size image.
  • Fig 3. 

    TH2 cytokines cause sFasL release and a transient increase in mFasL presentation. A, Western blots showing MMP-3 and MMP-7 expression in 1HAEo− and 16HBE14o− cells. B, sFasL ELISA of supernatants from cytokine-treated 1HAEo− cells. ∗∗P < .01 versus untreated control, ANOVA (n = 3). C, mFasL expression on cytokine-treated 1HAEo− cells, as determined by means of FACS analysis. ∗P < .05, Student t test (n = 5-8).

We next used FACS to measure cell-surface mFasL expression (Fig 3, C, and see Fig E2, A, in this article's Online Repository at www.jacionline.org). Untreated 1HAEo− cells show mFasL expression levels of 13.2% ± 6.4%, which increase significantly 1.6-fold to 19.7% ± 6.9% (4 hours after cytokine treatment; Fig 3, C). Cytokine-induced increase in mFasL presentation at the cell surface is transient, returning to control levels at 16 hours after treatment (12.2% ± 5.0%).

We investigated whether the transient increase in mFasL levels and release of sFasL from TH2 cytokine–treated 1HAEo− cells was preceded by increased FasL gene transcription (see Fig E2, B). We demonstrate a significant reduction in FasL transcripts at 4 hours (0.69-fold ± 0.14-fold vs untreated control cells), 8 hours (0.61-fold ± 0.22-fold vs untreated control cells), and 16 hours (0.50-fold ± 0.11-fold vs untreated control cells) after treatment, returning to control levels at 24 hours. The absence of increased FasL gene expression suggests a cytoplasmic pool of FasL is translocated to the cell membrane before shedding as sFasL.

Cellular MMP-7 and FasL distribution after cytokine addition 

We used confocal microscopy to test whether the transient increase in mFasL levels and subsequent release from the cell surface between 4 and 16 hours after cytokine treatment was due to increased colocalization of FasL with MMP-7 at the cell membrane (Fig 4). In unstimulated cells (0 hours) MMP-7 is distributed throughout the cytoplasm of the cell, and at the cell membrane, FasL is present in the cell nuclei and cytoplasm; however, colocalization is low (rp = 0.460 ± 0.045). Four hours after cytokine addition, cell-surface MMP-7 staining is increased, but colocalization with FasL remains low (rp = 0.396 ± 0.082). At 8 hours, strong MMP-7 and FasL staining is present throughout the cell. Yellow signal indicates that FasL and MMP-7 are colocalized within the cell cytoplasm, and Z-plane cross-sections of the merged image show colocalization also at the cell membrane, confirmed by a significant increase in rp (0.685 ± 0.097). This effect persists through 24 hours (rp = 0.696 ± 0.109). These results show that TH2 cytokine exposure induces colocalization of MMP-7 with FasL in the cytoplasm and at the cell surface from 8 to 24 hours after treatment.

  • View full-size image.
  • Fig 4. 

    TH2 cytokines trigger MMP-7/FasL colocalization. A, Confocal images of 1HAEo− cells from 0 (untreated) to 24 hours after cytokine treatment stained for MMP-7 (green), FasL (red), nuclei (blue), and a 3-dimensional merged image (M). B, Yellow MMP-7/FasL colocalization signal was quantified by using Pearson correlation values. ∗∗P < .01 versus untreated control, ANOVA (n = 3-7 fields).

Recombinant active MMP-7 causes release of sFasL 

To show that MMP-7 is capable of directly cleaving mFasL, we treated 1HAEo− cells (Fig 5) and primary HBECs (see Fig E3 in this article's Online Repository at www.jacionline.org) with active rhMMP-7. Six hours of treatment with rhMMP-7 caused a concentration-dependent release of sFasL, reaching significance at 1 μg/mL in 1HAEo− cells (Fig 5, A) and primary HBECs. A time course shows maximal sFasL release from 1HAEo− cells at 4 hours (Fig 5, B). rhMMP-7–induced release of sFasL corresponds to reduced mFasL presentation by means of FACS analysis (Fig 5, C).

  • View full-size image.
  • Fig 5. 

    Recombinant MMP-7 causes AEC sFasL release and reduces cell-surface mFasL levels. A, sFasL ELISA of 1HAEo− supernatants after 6 hours of incubation with rhMMP-7. B, Time course of sFasL release with 1 μg/mL rhMMP-7. ∗∗P < .01 versus untreated controls, ANOVA (n = 3-4). C, FACS shows that 4 hours of rhMMP-7 treatment reduces 1HAEo− cell mFasL levels. ∗P < .05 versus untreated control, ANOVA (n = 4).

MMP-7–specific knockdown by siRNA prevents loss of mFasL 

We used siRNA technology to test the hypothesis that endogenous MMP-7 is necessary for cytokine-stimulated cleavage of mFasL from AECs (Fig 6). Sixteen hours after cytokine treatment, 1HAEo− cells transfected with 100 nmol/L MMP7 siRNA show less caseinolytic activity in supernatants at a molecular weight that corresponds to MMP-7 by means of Western blotting compared with scrambled siRNA-transfected control cells (Fig 6, A and B). After gene silencing of MMP-7, mFasL presentation measured by means of FACS remains increased compared with that seen in control cells at 16 hours after cytokine treatment (Fig 6, C, and see Fig E4 in this article's Online Repository at www.jacionline.org), suggesting endogenous MMP-7 activity is required for mFasL cleavage from the cell surface after cytokine treatment.

  • View full-size image.
  • Fig 6. 

    siRNA knockdown of MMP-7 inhibits mFasL cleavage. A, Casein zymograms demonstrate proteolytic activity in 1HAEo− supernatants corresponding to the major band in MMP-7–stained cell lysate (i). Fig 6, A (ii), and B, Transfection with MMP7–specific siRNA reduced MMP-7 activity compared with that seen in scrambled siRNA-transfected controls. C, FACS to show mFasL expression in MMP7 siRNA and scrambled siRNA-transfected 1HAEo− cells 16 hours after cytokine treatment. ∗P < .05, ANOVA (n = 7).

Back to Article Outline

Discussion 

How chronic damage and activation of an epithelial repair phenotype might contribute to airway remodeling and inflammation in asthma is largely unknown. The effects of the asthmatic TH2 cytokine environment on airway epithelial function are likely numerous and also undetermined. MMP-type proteases are increasingly recognized as specific modulators of cell-signaling pathways important in inflammatory disease through the targeted cleavage of non-ECM substrates, including cytokines, chemokines, growth factors, and their receptors. MMP gene transcription and activity is regulated by complex and probably cell-specific pathways19; however, to date, there are few published data concerning the regulation of airway epithelial MMPs by an asthma-like TH2 environment. Here we demonstrate dysregulated MMP-7 expression in the airway epithelium from asthmatic patients. In our epithelial model system, TH2 cytokines specifically increase the transcription and activity of MMP-3 and MMP-7. We show MMP-7 cleaves mFasL, causing release of the potent neutrophil chemoattractant FasL,16 and thus cytokine-induced MMP-7 might prove to be an important contributor to airway inflammation in patients with asthma.

In our study the epithelium from the large airways of nonasthmatic subjects was well differentiated, with MMP-7 expression and activity strongest in ciliated apical cells. Constitutive secretion of MMP-7 into the airway lumen confirms previous studies suggesting that MMP-7 has a role in the innate mucosal immunity of the airway,32 perhaps by activating antibacterial defensins.33 Other studies also show that MMP-7 is rarely expressed in basal epithelial cells of the normal airway, except during wound repair, when it is found on the basal aspect of migrating cells.25, 26, 34 We found MMP-7 throughout a poorly differentiated epithelium in asthmatic patients, including basal cells. This might be a normal response to injury in asthma and might reflect a lack of terminal differentiation and activation of an epithelial repair phenotype thought to be important in the remodeling response of the asthmatic airway.10

For in vitro experiments, we created a model of the airway epithelium in asthma by treating the 1HAEo− and 16HBE14o− AEC lines with a mix of TH2 cytokines (IL-4, IL-9, and IL-13). 1HAEo− and 16HBE14o− cells remain as relatively undifferentiated cells with basal cell–like phenotypes in submerged culture27, 28, 35, 36 and are therefore suitable models for the basal epithelial cells that often remain in the damaged epithelium of asthmatic patients. The natural dedifferentiation of ciliated epithelial cells during wound repair37 would also suggest that a basal-like cell is the appropriate cellular phenotype for our in vitro studies. It should be noted that TH2 cytokines, including IL-13 and IL-4, have been shown to influence the differentiation of AECs in air-liquid interface cultures,38 which is consistent with changes identified in the airways of asthmatic patients in vivo.

Here we show that exposure of 1HAEo− AECs to an asthmatic cytokine milieu increases endogenous MMP-7 activity, which results in the release of sFasL. Several of our observations indicate the endogenous regulation of MMP activity and FasL cleavage is more complex than upregulation of gene transcription and protease release. Neutrophils contain cytoplasmic stores of gelatinases and collagenases,19 and our data suggest that release of preformed stored MMPs similarly occurs in 1HAEo− cells; MMP-3 and MMP-7 activity is increased in cell supernatants before measurable increases in MMP mRNA, and immunolabeling demonstrates that cytoplasmic MMP-7 is already present (albeit at lower levels) in unstimulated 1HAEo− cells. Increased gene expression after initial MMP release might function to replace the intracellular pool of MMPs.

The colocalization of MMP-7/FasL we observed in cells after cytokine treatment will serve to increase their local concentrations, suggesting cleavage of mFasL from the cell surface by endogenous MMP-7 requires a microenvironment in which enzyme and substrate are at high concentrations. Although MMP-7 does not possess a transmembrane domain, studies with mammary and uterine epithelium demonstrate that MMP-7 physically associates with the hyaluronan receptor (CD44) at the cell surface, where it cleaves and activates pro-HB-EGF.39 Thus MMP-7 might be presented to substrates at the cell surface, including mFasL, in local domains of high concentration. Compartmentalization of MMP-7 through CD44 might explain why relatively high concentrations of exogenous MMP-7 were required for mFasL cleavage in our assays.

In other cell systems MMP-3 has been shown to cleave mFasL directly21 and, as a potential activator of MMP-7, might be upstream of the MMP-7–mediated FasL cleavage that we have demonstrated.19 We observed no sFasL release in a cell system that lacks active MMP-7 (16HBE14o− cells). Our data clearly show that MMP-7 expression is dysregulated in the epithelium of asthmatic patients; however, we cannot discount MMP-3 as a potential mediator of FasL release in vivo. The in vitro studies demonstrate that MMP-7 is sufficient and necessary for FasL release; recombinant MMP-7 is capable of cleaving mFasL from epithelial cells, whereas siRNA targeted against MMP7 reduces the loss of mFasL from the epithelial cell after cytokine treatment. In vivo studies confirm that MMP-7 can regulate inflammation neutrophilic inflammation, is common in patients with acute severe asthma,40 and MMP-7 plays a vital role in controlling the transepithelial influx of neutrophils in a murine model of colon injury through the luminal release of the neutrophil chemokines.41 MMP-7 activity might also trigger eosinophilic airways inflammation; MMP7–null mice have reduced bronchial hyperresponsiveness to allergen, fewer eosinophils, and lower levels of IL-25 and eotaxin in the bronchoalveolar lavage fluid compared with wild-type mice.42 Our study elucidates a novel mechanism whereby MMP-7 might play a similarly important role in regulating airway inflammation in vivo in patients with asthma through release of the pro-inflammatory chemokine, sFasL.

In our in vitro model cytokine-induced FasL release and increased mFasL presentation was accompanied by a decrease in FasL gene expression, which might reflect an attempt to control the resulting inflammatory signal. FasL gene expression is known to be regulated by a variety of transcription factors; however, the most likely candidate for mediating cytokine-induced inhibition of FasL transcription might be the Forkhead (FKHR) family. When dephosphorylated, FKHR translocates to the nucleus and binds a FKRH-responsive element within the FasL promoter, activating gene transcription.43 When Akt signaling is activated, such as after IL-4 or IL-13 treatment,44, 45 FKHR is phosphorylated and therefore does not bind to the FasL promoter.43 TH2 cytokines might thus inhibit FasL promoter activity in AECs through an Akt/FKHR-dependent mechanism.

The discovery of novel substrates for MMP-7 suggests the molecule has evolved to serve a variety of roles. Many are undoubtedly beneficial (eg, activation of antibacterial defensins or promotion of epithelial repair), whereas other proinflammatory functions are useful in the acute-phase response to injury. The studies presented here demonstrate that MMP-7 might be important in airway epithelial health and control of inflammation through direct cleavage of mFasL from the epithelial surface. It is probable that the increased basolateral expression of MMP-7 in the airway epithelium of asthmatic patients leads to cleavage and release of sFasL, contributing to inflammation through neutrophil influx and epithelial damage through removal of the mFasL-mediated immune barrier.14 If the cytokine environment in the airways of asthmatic patients generates a persistent increase in epithelial MMP-7 expression and activity, then the short-term benefits of acute inflammation and epithelial repair might develop into the pathological tissue remodeling and chronic inflammation associated with severe disease.

Key messages


•Epithelial expression of mFasL acts as a protective immune barrier. mFasL can be cleaved from AECs by MMP-7, which is dysregulated in the asthmatic epithelium.

•FasL cleavage by MMP-7 might contribute to the asthma phenotype. sFasL acts as a neutrophil chemokine, and loss of the cell-surface FasL immune barrier exposes epithelial cells to immune cell–mediated death.

•TH2 cytokines upregulate MMP-7 expression in AECs and stimulate colocalization of MMP-7 with FasL, triggering FasL cleavage and release. The inflammatory environment of the asthmatic airway might therefore contribute to disease through stimulation of specific epithelial proteases.

Back to Article Outline

 

We thank Drs Darryl Knight, James Hogg, and Mark Elliott for tissue collection; Dr Thomas Abraham for confocal microscopy training and advice; Crystal Leung and Amrit Aitken for tissue processing; and Dr Beth Whalen and Anna Meredith for FACS services.

Back to Article Outline

Methods 

MMP-7 immunohistochemistry 

Tissue from the tracheas and large bronchi of donor lungs was dissected, formalin fixed, and paraffin wax embedded, and 5-μm sections were cut onto glass slides. Immunohistochemistry was performed according to standard protocol. Briefly, slides were dewaxed, rehydrated, and blocked in universal protein block (Dako) for 30 minutes. Slides were stained overnight at 4°C with a murine monoclonal anti–MMP-7 antibody (ID-2, Calbiochem) at 4 μg/mL in Tris-buffered saline (TBS) plus 1% BSA, followed by a biotin-conjugated goat anti–mouse IgG secondary antibody (BA-9200; Vector Laboratories, Burlingame, Calif) at a 1:250 dilution. Bound antibody was labeled with an Avidin-Biotin Complex (DakoCytomation ABC Complex/AP) amplification step. Cell nuclei were counterstained with hematoxylin. MMP-7 positivity was assessed manually; 5 to 6 ×20 bright-field images (Nikon Eclipse E600 microscope) of sections from the large airways of 5 pediatric asthmatic patients and 5 healthy subjects were digitally captured (SpotFlex camera; Diagnostic Instruments, Sterling Heights, Mich), with the observer blinded to patient status. A digital grid was overlaid onto each image (ImageProPlus, Media Cybernetics), MMP-7+ apical cells (cells touching the airway lumen) and basal cells (cells touching the basement membrane) were manually counted, and the basement membrane length was calculated for each image. Cell numbers are expressed as the number of cells per millimeter of basement membrane length.

MMP-7–selective fluorescent ISZ 

Frozen lung tissue from adult patients without asthma was obtained from the iCAPTURE tissue registry. Five- to 10-μm-thin sections were cut from OCT (Tissue-Tek, Torrance, Calif) inflated and embedded airways. Fluorescent ISZ was performed with PB-M7VIS, an MMP-7–selective substrate with a relatively high rate of cleavage by MMP-7 (Kcat/Km [M−1s−1] = 1.9 ± 0.2 × 105).E1 Tissue sections on slides were quickly warmed to room temperature and overlaid with 40 μL of liquefied 1% low-gelling-temperature agarose (Invitrogen) containing PB-M7VIS (1 μmol/L) in ISZ buffer (100 mmol/L NaCl, 10 mmol/L CaCl2, 20 mmol/L ZnCl2, 100 mmol/L Tris [pH 7.5], and 0.05% Brij35) with DAPI (5 μg/mL). Negative controls were prepared either in ISZ buffer without PB-M7VIS or with PB-M7VIS in saline buffer without divalent cofactors. After placing a coverslip, the agarose solution was allowed to set, and slides were incubated at 37°C in a dark humidified chamber for 6 hours. FITC (sensor), TRITC (reference), and DAPI images were captured at several time points by means of wide-field fluorescence microscopy (Eclipse TE300) with a color digital camera (SpotFlex camera, Diagnostic Instruments) and associated imaging software (Spot, Image Diagnostics). Exposure times and gain settings remained constant throughout each experiment. FITC and TRITC signal intensities in the epithelium were quantified with ImageJ image analysis software (http://rsbweb.nih.gov/ij/), and the FITC/TRITC ratio was calculated for each time point. Reaction kinetics were monitored with a Genios fluorescent plate reader (Tecan, Mannedorf, Switzerland); in a black, flat-bottomed 96-well plate (Corning, Corning, NY), 100 μL of PB-M7VIS substrate in ISZ buffer (as above) was incubated with recombinant human active MMP-7 (1,000 ng/mL, Calbiochem) in a dark humidified chamber at 37°C. FITC (Exλ, 485 nm; Emλ, 535nm) and TRITC (Exλ, 530 nm; Emλ, 595 nm) signals were measured. MMP-7 was also incubated with a panspecific MMP substrate, ES010 (10 μmol/L, R&D Systems; (Exλ, 360 nm; Emλ, 465 nm) to confirm activity.

Fluorescent confocal microscopy 

1HAEo− cells grown in 8-chamber glass slides were treated with IL-4, IL-9, and IL-13 in combination. Cells were fixed in 4% paraformaldehyde at several time points, permeabilized, and blocked in TBS plus 1% BSA. Cells were dual labeled sequentially with polyclonal rabbit anti-FasL (SC-834, 1:50, Santa Cruz Biotechnology) and monoclonal murine anti–MMP-7 (ID-2, 1:200, Calbiochem) primary antibodies (or appropriate isotype controls), with corresponding secondary antibodies (anti-rabbit Alexa-Fluor 594, anti-mouse Alexa-Fluor 488, both 1:200; Molecular Probes, Eugene, Ore). Nuclei were counterstained with DAPI (2-4 μg/mL), placed under a coverslip, and imaged with an AOBS Leica Confocal TCS SP2 microscope (63x/NA1.2; Leica, Heidelberg, Germany). Lambda scans were performed to confirm specificity of Alexa fluor emission profiles. Image stacks (512 × 512 pixels, 3-frame average) were collated with Improvision Volocity software, with photomultiplier (PMT) levels constant throughout each experiment. Three to 7 random fields were captured for each experimental condition, with 4 to 10 cells within each field. Three-dimensional MMP-7/FasL colocalization was quantified in individual cells with Volocity software; thresholds were automatically set by using mean FITC and TRITC channel intensities, and values are expressed by using the Pearson correlation as an unbiased means of quantifying colocalization (rp of 0-0.5, random colocalization; rp > 0.5, specific colocalization).E2 Voxel sizes are approximately 100 nm × 100 nm × 100 nm for each 3-dimensional Z-stack.

Reverse transcription and real-time PCR 

For MMP experiments, reverse transcriptase was used for first-strand cDNA synthesis after priming with oligo-dT (Qiagen, Ontario, Canada). The reaction was performed in 21-μL reactions containing 5 μg of RNA, 1× standard buffer, 12.5 ng of oligo-dT, 5 mmol/L dithiothreitol, 0.5 mmol/L deoxyribonucleoside triphosphates, 0.6 U of Superscript II (Invitrogen, Ontario, Canada), and 1 U of RNase (Promega, Madison, Wis). The reaction was incubated at 38°C for 60 minutes, heated at 90°C for 10 minutes, and cooled to 4°C. The cDNA sample was purified by means of Montage PCR.

Quantitative real-time PCR for MMPs was performed in a LightCycler (Roche, Mannheim, Germany) with a 20-μL volume containing 1 μL of cDNA, 10 μL of Mastermix (Qiagen), and 0.5 μg of both primers (designed by Oligo software, see Table E1 for primer sequences). Preincubation was 15 minutes at 95°C to activate Taq polymerase, with amplification by 50 cycles of 20 seconds at 95°C, 20 seconds at 50°C, and 20 seconds at 72°C. After amplification, the temperature was increased by 0.2°C/s from 55°C to 95°C for melting curve analysis. Products were confirmed by means of electrophoresis on a 3% agarose gel stained with ethidium bromide. Gene expression was quantified with LightCycler software and expressed as fold relative to a β-actin housekeeping control. For FasL mRNA quantification, 1 μg of RNA was Trizol extracted from 1HAEo− cells at different time points after cytokine treatment and DNaseI treated (10 minutes at 60°C, Invitrogen). Sixty-six nanograms of RNA was loaded to a 15-μL reaction mix in a 384-well plate in triplicate, containing products from the SuperScript III Platinum SYBR Green one-step qRT-PCR kit with ROX reference dye (Invitrogen) and either FasL or HPRT housekeeping forward and reverse primers at 10 μmol/L (see Appendix 1). The cDNA synthesis step was 3 minutes at 50°C and Taq polymerase activation for 5 minutes at 95°C, with PCR amplification by means of 40 cycles of 15 seconds at 95°C, 3 seconds at 60°C, and 60 seconds at 40°C. After amplification, the temperature was increased by 0.2°C/s from 55°C to 95°C for melting curve analysis. Data were analyzed with ABI software, and results were expressed as fold expression relative to untreated (control) cells and normalized to HPRT: ▵▵CT = [(CTFasL-CTHPRT)TREATED − (CTFasL-CTHPRT)CONTROL]. Fold expression change is defined as 2−▵▵CT.

Western blot analysis 

Cell protein extracts and media supernatants were used for Western blot analysis. Forty micrograms of nonreduced samples were electrophoresed in 12% SDS-PAGE gel and then transferred to nitrocellulose membrane. The membrane was blocked for 1 hour at room temperature in TBST (10 mmol/L Tris-HCl, 150 mmol/L NaCl, and 0.05% Tween-20) containing 5% skimmed milk. The membrane was then incubated overnight at 4°C in TBST containing 2.5% skimmed milk with a 1:200 dilution of monoclonal murine anti–MMP-7 antibody (ID2, Calbiochem). The membrane was washed 3 times with TBST, followed by an incubation step with a 1:2,000 dilution of horseradish peroxidase–labeled goat anti-mouse IgG (BD Biosciences Canada, Mississauga, Ontario, Canada). Samples were detected with enhanced chemiluminescence (Supersignal West Femto; Pierce, Cheshire, United Kingdom).

Casein gel zymogram MMP assay 

Unboiled samples were diluted in sample-reducing buffer (2×) consisting of 0.5 mmol/L Tris (pH 6.8), 2% SDS, 20% glycerol, and 0.02% bromophenol blue and loaded onto a 12% polyacrylamide gel containing 0.05% casein (Invitrogen). Electrophoresis was carried out at 125 V for 100 to 120 minutes in SDS-containing zymogram running buffer (Invitrogen), gels were washed in 100 mL of renaturing buffer (Invitrogen) for 30 minutes at room temperature and then incubated with 100 mL of developing buffer (Invitrogen) for 2 days at 37°C, fresh developing buffer was added, and gels were incubated for a further 2 days. After incubation, gels were stained in 40 mL of Coomassie Blue Stain (5% Coomassie; Diversified Biotech, Boston, Mass), 5% acetic acid, and 15% methanol for at least 1 hour, and destained in 30% acetic acid and 10% methanol until a transparent band was detected against a blue background.

siRNA-targeted knockdown of MMP-7 

Briefly, cells were seeded into 24-well plates and cultured overnight to 30% to 40% confluency. Medium was replaced with 500 μL per well Dulbecco minimum essential medium plus 10% FBS, and 100 μL per well of MMP-7–specific siRNA (ON-TARGETplus SMARTpool, Dharmacon) was added at final concentrations of 10 to 100 nmol/L with 3 μL per well of HiPerFect transfection reagent (Qiagen; later experiments used Accel serum-free siRNA delivery medium [Dharmacon]). Control cells were transfected with a pool of scrambled control siRNAs (ON-TARGETplus negative control, Dharmacon) or treated with transfection media alone.

Back to Article Outline

Fig E1. 

  • View full-size image.

  • Fluorescence ISZ demonstrates airway epithelial MMP-7 activity. A and B, Airway epithelium stained with DAPI and hematoxylin and eosin (H&E), respectively. C, Airway sections incubated with PB-M7VIS substrate demonstrate substrate cleavage in the epithelium (arrows) by means of FITC signal at 2 hours. D, TRITC reference. E, Epithelial FITC/TRITC ratio was quantified at several time points. F, A fluorescent plate assay using rhMMP-7 and PB-M7VIS shows similar FITC/TRITC kinetics to tissue, with no change in negative controls.

Back to Article Outline

Fig E2. 

  • View full-size image.

  • 1HAEo− cell mFasL expression by means of FACS analysis and FasL mRNA quantification after cytokine addition. A, mFasL FACS traces of 1HAEo− cells 4 hours after cytokine treatment. B, Postcytokine FasL mRNA expression determined by means of real-time PCR. ∗P < .05 and ∗∗P < .01 versus untreated control, ANOVA (n = 3).

Back to Article Outline

Fig E3. 

  • View full-size image.

  • Recombinant MMP-7 causes sFasL release from primary HBECs. A, sFasL ELISA of supernatants from primary HBECs after 6 hours of incubation with rhMMP-7. B, MMP-7 (1 μg/mL) causes rapid sFasL release. ∗∗P < .01 versus untreated controls, ANOVA (n = 3-4).

Back to Article Outline

Fig E4. 

  • View full-size image.

  • MMP -7 siRNA inhibits mFasL cleavage after cytokine treatment. FACS traces show mFasL expression by 1HAEo− cells transfected with 100 nmol/L MMP-7 or scrambled siRNA 16 hour after cytokine treatment.

Back to Article Outline

Table E1. 

MMP and TIMP primer sequences
PrimerSequence
MMP-25′-TTTCCATTCCGCTTCCAGGGCACAT
5′-TCACTGCCTTTCTACACCACACGCT
MMP-35′-AATCCTACTGTTGCTGTG
5′-ACAAGGTTCATGCTGGTG
MMP-75′-TCTCCATTTCCATAGGTTG
5′-TTGATGGGCCAGGAAACA
MMP-95′-GGCAGGACCGTCTCTACTGGCGCGT
5′-CAGAACAGAATACCAGTTTGTATC
TIMP-15′-TGGACTCTTGCACATCACTACC
5′-CCAACAGTGTAGGTCTTGGTGA
TIMP-25′-CGTTTTGCAATGCAGATGTAGT
5′-CTGGATCCTCTTGATAGGGTTG
ADAM-105′-TACGAATGAAGAGGGACACTTCCC
5′-GCTCTTCGACACTAACGGGTCTAT
ADAM-175′-ATGAGGCAGTCTCTCCTATTCC
5′-GGTGGACTTCTCGAACAAGTAG
FasL5′-TGCCACCCCTGAAGAAGAGA
5′-CTACCAAGGCAACCAGAACCA
HPRT-15′- TGACACTGGCAAAACAATGCA
5′- GGTCCTTTTCACCAGCAAGCT

Back to Article Outline

Table E2. 

Baseline MMP mRNA expression in 1HAEo− cells
mRNA expression relative to β-actin (× 10−3) in 1HAEo− cells
MMP-24.367 ± 0.0030 [SD]
MMP-30.720 ± 0.0023
MMP-70.081 ± 0.0001
MMP-91.664 ± 0.0012
TIMP-112.433 ± 0.1709
TIMP-212.155 ± 0.0103
ADAM-107.181 ± 0.0055
ADAM-1716.090 ± 0.0098

mRNA expression for various MMPs and their inhibitors in resting 1HAEo− cells was measured by means of semiquantitative PCR. Relative expression levels are expressed as fold versus the β-actin housekeeping gene (n = 8-25).

Back to Article Outline

References 

  1. Robinson DS, Hamid Q, Ying S, Tsicopoulos A, Barkans J, Bentley AM, et al. Predominant TH2-like bronchoalveolar T-lymphocyte population in atopic asthma. N Engl J Med. 1992;326:298–304
  2. Kuperman DA, Huang X, Koth LL, Chang GH, Dolganov GM, Zhu Z, et al. Direct effects of interleukin-13 on epithelial cells cause airway hyperreactivity and mucus overproduction in asthma. Nat Med. 2002;8:885–889
  3. Bhathena PR, Comhair SA, Holroyd KJ, Erzurum SC. Interleukin-9 receptor expression in asthmatic airways in vivo. Lung. 2000;178:149–160
  4. Laitinen LA, Heino M, Laitinen A, Kava T, Haahtela T. Damage of the airway epithelium and bronchial reactivity in patients with asthma. Am Rev Respir Dis. 1985;131:599–606
  5. Beasley R, Roche WR, Roberts JA, Holgate ST. Cellular events in the bronchi in mild asthma and after bronchial provocation. Am Rev Respir Dis. 1989;139:806–817
  6. Vignola AM, Chanez P, Campbell AM, Souques F, Lebel B, Enander I, et al. Airway inflammation in mild intermittent and in persistent asthma. Am J Respir Crit Care Med. 1998;157:403–409
  7. Dorscheid DR, Wojcik KR, Sun S, Marroquin B, White SR. Apoptosis of airway epithelial cells induced by corticosteroids. Am J Respir Crit Care Med. 2001;164:1939–1947
  8. Smith DL, Deshazo RD. Bronchoalveolar lavage in asthma. An update and perspective. Am Rev Respir Dis. 1993;148:523–532
  9. Lackie PM, Baker JE, Gunthert U, Holgate ST. Expression of CD44 isoforms is increased in the airway epithelium of asthmatic subjects. Am J Respir Cell Mol Biol. 1997;16:14–22
  10. Holgate ST. The bronchial epithelial origins of asthma. Chem Immunol. 2000;78:62–71
  11. Puddicombe SM, Polosa R, Richter A, Krishna MT, Howarth PH, Holgate ST, et al. Involvement of the epidermal growth factor receptor in epithelial repair in asthma. FASEB J. 2000;14:1362–1374
  12. Durieu I, Amsellem C, Paulin C, Chambe MT, Bienvenu J, Bellon G, et al. Fas and Fas ligand expression in cystic fibrosis airway epithelium. Thorax. 1999;54:1093–1098
  13. Ferguson TA, Griffith TS. A vision of cell death: Fas ligand and immune privilege 10 years later. Immunol Rev. 2006;213:228–238
  14. Hamann KJ, Dorscheid R, Ko FD, Conforti AE, Sperling AI, Rabe KF, et al. Expression of Fas (CD95) and FasL (CD95L) in human airway epithelium. Am J Respir Cell Mol Biol. 1998;19:537–542
  15. Druilhe A, Wallaert B, Tsicopoulos A, Lape e Silva JR, Tillie-Leblond I, Tonnel AB, et al. Apoptosis, proliferation, and expression of Bcl-2, Fas, and Fas ligand in bronchial biopsies from asthmatics. Am J Respir Cell Mol Biol. 1998;19:747–757
  16. Ottonello L, Tortolina G, Amelotti M, Dallegri F. Soluble Fas ligand is chemotactic for human neutrophilic polymorphonuclear leukocytes. J Immunol. 1999;162:3601–3606
  17. Seino K, Iwabuchi K, Kayagaki N, Miyata R, Nagaoka I, Matsuzawa A, et al. Chemotactic activity of soluble Fas ligand against phagocytes. J Immunol. 1998;161:4484–4488
  18. Schneider P, Holler N, Bodmer JL, Hahne M, Frei K, Fontana A, et al. Conversion of membrane-bound Fas(CD95) ligand to its soluble form is associated with downregulation of its proapoptotic activity and loss of liver toxicity. J Exp Med. 1998;187:1205–1213
  19. Chakraborti S, Mandal M, Das S, Mandal A, Chakraborti T. Regulation of matrix metalloproteinases: an overview. Mol Cell Biochem. 2003;253:269–285
  20. Tanaka M, Suda T, Haze K, Nakamura N, Sato K, Kimura F, et al. Fas ligand in human serum. Nat Med. 1996;2:317–322
  21. Matsuno H, Yudoh K, Watanabe Y, Nakazawa F, Aono H, Limura T. Stromelysin-1 (MMP-3) in synovial fluid of patients with rheumatoid arthritis has potential to cleave membrane bound Fas ligand. J Rheumatol. 2001;28:22–28
  22. Powell WC, Fingleton B, Wilson CL, Boothby M, Matrisian LM. The metalloproteinase matrilysin proteolytically generates active soluble Fas ligand and potentiates epithelial cell apoptosis. Curr Biol. 1999;9:1441–1447
  23. Vargo-Gogola T, Crawford HC, Fingleton B, Matrisian LM. Identification of novel matrix metalloproteinase-7 (matrilysin) cleavage sites in murine and human Fas ligand. Arch Biochem Biophys. 2002;408:155–161
  24. Rosas IO, Richards TJ, Konishi K, Zhang Y, Gibson K, Lokshin AE, et al. MMP1 and MMP7 as potential peripheral blood biomarkers in idiopathic pulmonary fibrosis. PLoS Med. 2008;5:e93
  25. Coraux C, Martinella-Catusse C, Nawrocki-Raby B, Hajj R, Burlet H, Escotte S, et al. Differential expression of matrix metalloproteinases and interleukin-8 during regeneration of human airway epithelium in vivo. J Pathol. 2005;206:160–169
  26. Dunsmore SE, Saarialjo-Kere UK, Roby JD, Wilson CL, Matrisian LM, Welgus HG, et al. Matrilysin expression and function in airway epithelium. J Clin Invest. 1998;102:1321–1331
  27. Cozens AL, Yezzi MJ, Kunzelmann K, Ohrui T, Chin L, Eng K, et al. CFTR expression and chloride secretion in polarized immortal human bronchial epithelial cells. Am J Respir Cell Mol Biol. 1994;10:38–47
  28. Cozens AL, Yezzi MJ, Chin L, Simon EM, Friend DS, Gruenert DC. Chloride ion transport in transformed normal and cystic fibrosis epithelial cells. Adv Exp Med Biol. 1991;290:187–196
  29. Patchell BJ, Wojcik KR, Yang TL, White SR, Dorscheid DR. Glycosylation and annexin II cell surface translocation mediate airway epithelial wound repair. Am J Physiol Lung Cell Mol Physiol. 2007;293:L354–L363
  30. McIntyre JO, Fingleton B, Wells KS, Piston DW, Lynch CC, Gautam S, et al. Development of a novel fluorogenic proteolytic beacon for in vivo detection and imaging of tumour-associated matrix metalloproteinase-7 activity. Biochem J. 2004;377:617–628
  31. Cho WJ, Daniel EE. Colocalization between caveolin isoforms in the intestinal smooth muscle and interstitial cells of Cajal of the Cav1(+/+) and Cav1 (-/-) mouse. Histochem Cell Biol. 2006;126:9–16
  32. Lopez-Boado YS, Wilson CL, Parks WC. Regulation of matrilysin expression in airway epithelial cells by Pseudomonas aeruginosa flagellin. J Biol Chem. 2001;276:41417–41423
  33. Wilson CL, Ouellette AJ, Satchell DP, Ayabe T, López-Boado YS, Stratman JL, et al. Regulation of intestinal alpha-defensin activation by the metalloproteinase matrilysin in innate host defense. Science. 1999;286:113–117
  34. McGuire JK, Li Q, Parks WC. Matrilysin (matrix metalloproteinase-7) mediates E-cadherin ectodomain shedding in injured lung epithelium. Am J Pathol. 2003;162:1831–1843
  35. Forbes B, Shah A, Martin GP, Lansley AB. The human bronchial epithelial cell line 16HBE14o- as a model system of the airways for studying drug transport. Int J Pharm. 2003;257:161–167
  36. Dorscheid DR, Conforti AE, Hamann KJ, Rabe KF, White SR. Characterization of cell surface lectin-binding patterns of human airway epithelium. Histochem J. 1999;31:145–151
  37. Keenan KP, Wilson TS, McDowell EM. Regeneration of hamster tracheal epithelium after mechanical injury. IV. Histochemical, immunocytochemical and ultrastructural studies. Virchows Arch B Cell Pathol Incl Mol Pathol. 1983;43:213–240
  38. Danahay H, Atherton H, Jones G, Bridges RJ, Poll CT. Interleukin-13 induces a hypersecretory ion transport phenotype in human bronchial epithelial cells. Am J Physiol Lung Cell Mol Physiol. 2002;282:L226–L236
  39. Yu WH, Woessner JF, McNeish JD, Stamenkovic I. CD44 anchors the assembly of matrilysin/MMP-7 with heparin-binding epidermal growth factor precursor and ErbB4 and regulates female reproductive organ remodeling. Genes Dev. 2002;16:307–323
  40. Ordoñez CL, Shaughnessy TE, Matthay MA, Fahy JV. Increased neutrophil numbers and IL-8 levels in airway secretions in acute severe asthma: Clinical and biologic significance. Am J Respir Crit Care Med. 2000;161:1185–1190
  41. Swee M, Wilson CL, Wang Y, McGuire JK, Parks WC. Matrix metalloproteinase-7 (matrilysin) controls neutrophil egress by generating chemokine gradients. J Leukoc Biol. 2008;83:1404–1412
  42. Goswami S, Barranco W, Greenlee KJ, Seryshev AB, Corry DB, Kharadmand F. Role of matrix-metalloprotease-7 in a model of experimental asthma. FASEB J. 2008;22:671.3
  43. Ciechomska I, Pyrzynska B, Kazmierczak P, Kaminska B. Inhibition of Akt kinase signalling and activation of Forkhead are indispensable for upregulation of FasL expression in apoptosis of glioma cells. Oncogene. 2003;22:7617–7627
  44. Grehan JF, Levay-Young BK, Fogelson JL, François-Bongarçon V, Benson BA, Dalmasso AP. IL-4 and IL-13 induce protection of porcine endothelial cells from killing by human complement and from apoptosis through activation of a phosphatidylinositide 3-kinase/Akt pathway. J Immunol. 2005;175:1903–1910
  45. Wang ML, Keilbaugh SA, Cash-Mason T, He XC, Li L, Wu GD. Immune-mediated signaling in intestinal goblet cells via PI3-kinase- and AKT-dependent pathways. Am J Physiol Gastrointest Liver Physiol. 2008;295:G1122–G1130

Back to Article Outline

References 

  1. McIntyre JO, Fingleton B, Wells KS, Piston DW, Lynch CC, Gautam S, et al. Development of a novel fluorogenic proteolytic beacon for in vivo detection and imaging of tumour-associated matrix metalloproteinase-7 activity. Biochem J. 2004;377:617–628
  2. Cho WJ, Daniel EE. Colocalization between caveolin isoforms in the intestinal smooth muscle and interstitial cells of Cajal of the Cav1(+/+) and Cav1 (-/-) mouse. Histochem Cell Biol. 2006;126:9–16

 Supported by operating grants from the Canadian Institutes of Health Research, the Canadian/British Columbia Lung Associations, and Allergen NCE and personal support awards from the BC-Lung Association (S. J. W.), the Michael Smith Foundation for Health Research (D. R. D.), and the Canadian Institutes of Health Research (D. R. D.).

 Disclosure of potential conflict of interest: J. O. McIntyre has received research support from the Susan G. Komen Foundation and the National Institutes of Health (NCI). The rest of the authors have declared that they have no conflict of interest.

PII: S0091-6749(10)00816-X

doi:10.1016/j.jaci.2010.05.015

The Journal of Allergy and Clinical Immunology
Volume 126, Issue 2 , Pages 366-374.e8, August 2010

Article Tools

* Image Usage & Resolution