The Journal of Allergy and Clinical Immunology
Volume 119, Issue 4 , Pages 944-951, April 2007

Allergenicity and antigenicity of wild-type and mutant, monomeric, and dimeric carrot major allergen Dau c 1: Destruction of conformation, not oligomerization, is the roadmap to save allergen vaccines

  • Gerald Reese, PhD

      Affiliations

    • From the Paul Ehrlich Institut, Department of Allergology, Langen
    • Corresponding Author InformationReprint requests: Gerald Reese, PhD, Paul-Ehrlich-Institut, Department of Allergology, Paul-Ehrlich-Str 51-59, D-63325 Langen, Germany.
    • ,
  • Barbara K. Ballmer-Weber, MD

      Affiliations

    • University Hospital, Allergy Unit, Department of Dermatology, Zurich
    • ,
  • Andrea Wangorsch, MS

      Affiliations

    • From the Paul Ehrlich Institut, Department of Allergology, Langen
    • ,
  • Stefanie Randow

      Affiliations

    • From the Paul Ehrlich Institut, Department of Allergology, Langen
    • ,
  • Stefan Vieths, PhD

      Affiliations

    • From the Paul Ehrlich Institut, Department of Allergology, Langen

Received 4 October 2006; received in revised form 28 November 2006; accepted 30 November 2006. published online 14 February 2007.

Langen, Germany, and Zurich, Switzerland

Article Outline

Background

Carrot allergy is caused by primary sensitization to birch pollen. Continuous carrot exposure results in additional Dau c 1–specific allergic responses. Thus, immunotherapy with birch pollen may not improve the food allergy.

Objective

Evaluation of mutation and oligomerization of the major carrot allergen, Dau c 1, in regard to alteration of antibody binding capacities, structure, and the ability to induce blocking IgG antibodies.

Methods

Measurement of IgE reactivities to monomers, dimers of wild-type and mutant Dau c 1.0104 and Dau c 1.0201, and Dau c 1.0104 trimer, their ability to induce blocking antibodies in mice, and their allergenic potency by histamine release.

Results

The reactivity of human IgE to the mutant dimer was reduced on average by 81%. Sera of immunized Balb/c mice showed specific IgG similar to the human IgE antibody response; Dau c 1.01 was more antigenic than Dau c 1.02. Both wild-type and mutant Dau c 1 variants induced cross-reacting IgG, which blocked binding of human IgE. The mutants were more antigenic than the wild-type forms, and the dimers induced higher IgG responses in mice than the monomers. The results of the histamine release experiments corroborated the findings of the antibody binding studies.

Conclusion

Destruction of native conformation rather than oligomerization is the appropriate strategy to reduce the allergenicity of Bet v 1–homologous food allergens.

Clinical implications

The dimer composed of mutants of Dau c 1.0104 and Dau c 1.0201 is a promising candidate vaccine for treatment of carrot allergy because of its high immunogenicity and drastically reduced allergenicity.

Key words: Dau c 1, isoforms, carrot allergen, allergen vaccine, mutation, secondary structure, hypoallergenic variant, monomer, dimer, trimer

Abbreviations used: CD, Circular dichroism, EAST, Enzyme-linked allergosorbent test, SIT, Specific immunotherapy

 

The major allergen Dau c 1 of carrot (Daucus carota) is a homologue of the major birch pollen allergen Bet v 1. Two isoforms sharing only approximately 50% amino acid sequence identity and 6 variants of Dau c 1 have been identified so far.1, 2, 3, 4 Clinical observations and cross-reactivity data2, 4, 5, 6, 7 suggest that carrot allergy is mainly a result of primary sensitization to birch pollen allergens; continuous exposure to carrots, however, results in recognition of discrete epitopes on the major allergen Dau c 1.2, 6 This effect is not limited to IgE-binding epitopes; T-cell epitope mapping showed that even though Bet v 1 is the primary sensitizing allergen in allergies to foods containing Bet v 1 homologues, the immune response to allergens such as Cor a 1 and Dau c 1 is at least in part Bet v 1–independent.8 This implies that immunotherapy with birch pollen allergens may not improve carrot allergy, and food allergies to birch pollen–related foods must be treated as a separate disease. Consistent with this view, studies on the effect of birch pollen immunotherapy on apple allergy revealed controversial results,9, 10, 11 despite the fact that Mal d 1 shares more than 60% amino acid sequence identity with Bet v 1 whereas the identity of Dau c 1 with Bet v 1 is below 40%. Novel strategies for allergen-specific immunotherapy (SIT) aim at the reduction of the IgE antibody-binding capacity of the allergen and preservation of their tolerogenic properties. Two strategies have been published that reduced IgE antibody binding capacity of Bet v 1 and its homologues: first, amino acid substitutions at position 112 with a proline12, 13, 14 and multiple mutations at other positions,15, 16 and second, oligomerization.17, 18, 19, 20, 21 To evaluate the contributions of mutation and oligomerization to the alteration of the antibody binding capacities, structure, and the ability to induce blocking IgG antibodies in mice with wild-type and mutant monomeric Dau 1.01 and Dau c 1.02, dimers of wild-type and mutant monomeric Dau 1.01 and Dau c 1.02 and the Dau c 1.01 trimer were studied.

Back to Article Outline

Methods 

Subjects 

The diagnosis of carrot allergy in 24 patients had been confirmed by double-blind placebo-controlled food challenges6 and/or by clinical history of carrot allergy,2 and elevated carrot-specific serum IgE was determined by CAP-FEIA (Phadia, Uppsala, Sweden; see this article's Table E1 in the Online Repository at www.jacionline.org).

Generation and production of recombinant wild-type and mutant Dau c 1 monomers and dimers, and removal of LPS 

N-terminally His-tagged Dau c 1.0104 (GenBank Z813624) and Dau c 1.0201 (GenBank AF456481) were produced as described.2 The dimer of wild-type Dau c 1.01 and Dau c 1.02 was generated by fusion PCR. Briefly, Dau c 1.01 and Dau 1.02 constructs, carrying sequences that overlapped with the respective 5′ or 3′ ends of the other allergen, were generated by PCR using Dauc1.01(+) 5′-ATGGGT GCCCAGAGCCATTCACTCGAGATC-3′, Dau1.01fus(-) 5′-CAGTCTTTTGGACACCCATATTAGCAATGAGGTAGG C-3′, Dau1. 02fus(+) GCCTACCTCATTGCTAATATGGGTGTCCAAAAGA CTG-3′, and Dau1.02(-) 5′-TTAGTTTGCTAGGAGGTAAGCCT CAACAGC-3′ as primers. These 2 constructs were fused by using Dau1.01(+) as forward primer and Dau1.02(-) as reverse primer. The C-terminally His-tagged Dau c 1.01 trimer was generated analogously to the Bet v 1 trimer.17 112P mutants of wild-type monomers and dimer were generated by site-directed mutagenesis (QuikChange Mutagenesis Kit; Stratagene, LaJolla, Calif). All Dau c 1 forms were purified by immobilized metal affinity chromatography. For the immunization of Balb/c mice, endotoxin was removed (EndoTrap; Profos, Regensburg, Germany).

Comparison of human IgE antibody reactivity to wild-type and mutant Dau c 1 dimers by enzyme-linked allergosorbent test 

Five micrograms of each allergen were coupled to cyanogen bromide-activated paper disks (Schleicher & Schuell, Dassel, Germany).22 For detection, the enzyme-linked allergosorbent test (EAST) kit (Allergopharma, Reinbek, Germany) was used according to the manufacturer's instructions.

Histamine release assay 

The Histamine Enzyme Immunoassay Kit (Immunotech, Marseille, France) was performed according to the manufacturer's instructions by using heparinized blood from 2 subjects with carrot allergy (PEI-61, PEI-62) and 1 without (PEI-232). The stimulation concentrations ranged from 1 ng/mL to 1 μg/mL for the recombinant allergens, and from 10 ng/mL to 10 μg/mL for the carrot extract.

Immunization of Balb/c mice and measurement of IgG antibody response 

Female mice 5 to 6 weeks old (BALB/c; Harlan-Winkelmann, Borchen, Germany) were immunized 6 times intraperitoneally with 0.01 μg/dose, 0.1 μg/dose, and 1.0 μg/dose of (1) the mixture of wild-type Dau c 1.01 and Dau c 1.02 monomers, (2) the dimer of wild-type Dau c 1.01 and Dau c 1.02, (3) the mixture of mutant Dau c 1.01 and Dau c 1.02 monomers, and (4) the dimer of mutant Dau c 1.01 and Dau c 1.02, respectively, using alum as adjuvant. At week 12, sera were collected and stored at −20°C. To determine the IgG response, ELISA plates (Maxisorb; Nunc, Wiesbaden, Germany) were coated over night at 4°C with antigen solution (0.25 μg/mL in 50 mmol/L sodium carbonate buffer, pH 9.6) and blocked. Dilution series (1:4, starting with 1:100) of the different mouse serum pools were added. After incubation with alkaline phosphatase–labeled goat antimouse IgG (1:5000; Sigma, Taufkirchen, Germany), p-nitrophenyl phosphate substrate was used to visualize antibody binding, and absorbance was read at 405 nm.

Inhibition ELISA 

ELISA plates were coated overnight at 4°C with 0.2 μg/100 μL and blocked. Dilution series of the mouse serum pools were added, followed by human serum pools containing 5 sera each. Biotinylated goat antihuman IgE (KPL, Gaithersburg, Md), NeutrAvidin-HRP (Pierce, Bonn, Germany), and 3,3′,5,5′-tetramethylbenzidine plus H2O2 were used for detection. Absorbance was read at 450 nm; the inhibition was calculated in percentages.

Circular dichroism spectroscopy 

Purified antigens were dialyzed against 10 mmol/L KH2PO4/K2HPO4 buffer, pH 7.4, and protein concentrations were adjusted to 5.2 μmol/L. Circular dichroism (CD) spectroscopy was performed on a J-810 S spectropolarimeter (Jasco, Groß-Umstadt, Germany). The mean residue ellipticity ([θ]m.r.w.) was calculated from the measured ellipticity [θ].23

Back to Article Outline

Results 

Folding of wild-type, mutant, monomers, and dimers of Dau c 1 isoforms 

The effect of oligomerization and/or mutations at an amino acid position (position 112) critical for the correct folding was studied by CD spectrometry. The comparison of wild-type and mutant monomers demonstrated that mutations at position 112 destroyed the secondary structures of mutants (Fig 1, A). Dimerization of wild-type Dau c 1.01 and Dau c 1.02 did not destroy the secondary structure of Dau c 1 (Fig 1, A and B). Even the mutant Dau c 1.01/02 dimer seemed to be partially folded. The Dau c 1.01 monomer and trimer exhibited identical CD spectra (Fig 1, C), demonstrating that the trimer had likely preserved the native conformation of the monomer.

  • View full-size image.
  • Fig 1. 

    Comparison of secondary structures by CD dichroism spectrometry: comparison of monomeric wild-type and mutant Dau c 1.01 and Dau c 1.02 (A); comparison of wild-type and mutant dimer (B); comparison of wild-type Dau c 1.01 monomer and trimer (C).

Murine IgG antibody response to wild-type, mutant, monomers, and dimers of Dau c 1 isoforms 

Mice were immunized with 1.0 μg/dose, 0.1 μg/dose, and 0.01 μg/dose of (1) the mixture of wild-type Dau c 1.01 and Dau c 1.02 monomers, (2) the dimer of wild-type Dau c 1.01 and Dau c 1.02, (3) the mixture of mutant Dau c 1.01 and Dau c 1.02 monomers, and (4) the dimer of mutant Dau c 1.01 and Dau c 1.02, respectively. Because the immunization with the 0.1 μg/dose always resulted in an antibody response very similar to those that were a result of the immunization with 1.0 μg/dose, Fig 2 shows only the antibody responses to 1.0 μg/dose and 0.01 μg/dose.

  • View full-size image.
  • Fig 2. 

    Titration of murine IgG antibody responses by ELISA. Immunogen and doses are given in the title of each subfigure (A-H). The explanation for the symbols representing the test antigens in the ELISA is given in B for all subfigures.

The immunization with 1 μg/dose of the mixture of monomeric Dau c 1.01 and Dau c 1.02 wild-types induced antibodies to all test antigens (Fig 2, A). The strongest antibody response was directed toward the dimer of the 2 Dau c 1 isoforms, whereas the SP112 mutant of Dau c 1.01 gave rise to the lowest antibody reactivity. The comparison of the wild-type forms with their mutant counterparts always showed that, as expected, higher antibody binding was observed toward the native forms. Dau c 1.01 had a higher immunogenicity than Dau c 1.02. This was corroborated further by the antibody responses after immunization with 0.1 μg/dose of the mixture of monomeric Dau c 1.01 and Dau c 1.02 wild-types, because only antibodies to wild-type Dau c 1.01 monomer and wild-type Dau c 1 dimer were detectable (Fig 2, B).

Immunization with any dose of wild-type Dau c 1 dimer (Fig 2, C and D) gave rise to an antibody response similar to that to 1 μg/dose and 0.1 μg/dose of the mixture of monomeric Dau c 1.01 and Dau c 1.02. Dimerization had a positive effect on the immunogenicity because the 0.01 μg dose of the dimer produced a clearly higher antibody response than the identical dose of the mixture of wild-type monomers (Fig 2, B and D).

Immunization with 1.0 μg/dose and 0.1 μg/dose of the mixture of mutant Dau c 1.01 and Dau c 1.02 monomers resulted in a very homogeneous antibody response to all test antigens except to mutant Dau c 1.02 (Fig 2, E). Similar antibody responses were induced by mutant Dau c 1.01/02 dimer (Fig 2, G and H). The higher antibody response to 0.01 μg/dose of the mixture of mutant Dau c 1.01 and Dau c.102 (Fig 2, F) in comparison with those of the mixture of wild-type Dau c 1.01 and Dau c.102 (Fig 2, B) suggested that the mutants had higher immunogenicity than the wild-type monomers. Furthermore, it seemed that mutants induced antibodies to other epitopes (linear?) than the wild-type forms because the antibody responses after immunization with mutants resulted in similar responses regardless of whether wild-types, mutants, monomers, or dimers were used as test antigens (eg, Fig 2, A, vs Fig 2, E; Fig 2, C, vs Fig 2, G).

Human IgE antibody response to wild-type, mutant, monomers, and dimers of Dau c 1 isoforms 

To study whether oligomerization of Dau c 1 isoforms affected the allergenic potency, the IgE antibody reactivities to the mixture of natural Dau c 1.01 and Dau c 1.02, the dimer thereof, and the Dau c 1.01 trimer were compared. The majority of sera (19/24) showed increased antibody binding to the dimer; the increase ranged from 11% to 115%. On the basis of linear regression analysis (r2 = 0.862), the average increase was approximately 11% (slope = 1.113; Fig 3, A), even though it did not reach statistical significance. Only the IgE antibodies of a single serum reacted significantly less to the wild-type dimer than to the mixture of the natural Dau c 1 isoforms. In this case, the detectable amount of specific IgE was reduced from >50 IU/mL to 12.5 IU/mL. The increased antibody binding capacity of the Dau c 1.01 trimer in comparison with that of monomeric Dau c 1.01 was statistically significant (P < .001) and ranged from 20% to 193%, which equaled an average increase of 60% (Fig 3, B; r2 = 0.906; slope = 1.600).

  • View full-size image.
  • Fig 3. 

    Correlation analysis of IgE antibody reactivities among monomeric and oligomeric, natural, and mutated Dau c 1 isoforms (A-D). One serum had a very high IgE antibody response (specific IgE > 50 IU/mL) to wild-type Dau c 1 forms and was not shown in this figure. This serum, however, was included for statistical and linear regression analysis.

To study the effect of structural integrity on the allergenic potency, Dau c 1.01 and Dau c 1.02 mutants (Dau c 1.01 S112P, Dau c 1.01 C112P) were generated, their secondary structures analyzed by CD spectrometry, and the IgE antibody binding capacity of the mixtures and the dimers of the wild-types and mutants analyzed by EAST. The antibody binding capacity of the mutant monomers were reduced to zero, whereas the mutant dimer retained some residual IgE antibody binding capacity even though all 24 sera demonstrated reduced antibody binding capacity ranging from −34% to −100%. The IgE antibody reactivity of the sera tested (21/24) was reduced by more than 80%, resulting in a median of −91%.

The measurements of released histamine (Fig 4) supported the findings obtained by the antibody binding studies. The wild-type forms of Dau c 1—including monomers, dimers, and the trimer—always had a higher biological activity than the mutant counterparts. The maximum release of the mutants, with 1 exception, basophils of subject PEI 62 stimulated with mutant Dau c 1.01 (Fig 4, B), was less than half of the maximal release of the wild-type constructs. However, the difference of allergenic potency of wild-type and mutant Dau c 1.01 expressed as the ratio of their half-maximal effective dose (ED50) was at least 1000-fold, but probably much higher because the release induced with the lowest dose (1 ng/mL) of the wild type protein still was not very much reduced at all. Furthermore, the data showed that oligomerization did not reduce the allergenic potency of Dau c 1; if a difference was observed at all, there was a tendency that that the dimer had a stronger allergenic potency than the monomers, and the trimer an even higher potency than the dimer (Fig 4, A).

  • View full-size image.
  • Fig 4. 

    Histamine release from peripheral basophils of 2 subjects with carrot allergy, PEI 61 (A) and PEI 62 (B), and a control subject without allergy, PEI 232 (C), after stimulation with carrot extract, Dau c 1.01 and Dau c 1.02 wild-type and mutant monomers and dimers, and Dau c 1.01 trimer.

Inhibition of human IgE antibody reactivity to Dau c 1.01 and Dau c 1.02 by mouse sera raised against mixtures/dimers of wild-type/mutant forms of Dau c 1.01 and Dau c 1.02 

All mouse sera were able to inhibit binding of human IgE antibody reactivity to both Dau c 1 isoforms (Fig 5, A and B). The kinetics of the inhibitions to Dau c 1.01 were almost independent of the immunogen (monomers vs dimers, wild-type vs mutant) used. The kinetic of the inhibition to Dau c 1.02 with the serum raised against the mixture of Dau c 1 wild-type monomers was different (Fig 5, B); more serum was needed to reach 50% of maximal inhibition.

  • View full-size image.
  • Fig 5. 

    Inhibition of human IgE antibody reactivities to Dau c 1.01 (A) or Dau c 1.02 (B) by murine serum pools. Mice were immunized with mixtures of wild-type and mutant Dau c 1.01 and Dau c 1.02 as well as the corresponding dimers.

Back to Article Outline

Discussion 

The aim of this study was to evaluate the contributions of mutation and oligomerization of the major carrot allergen, Dau c 1, to the alteration of the antibody binding capacities, structure, and the ability to induce blocking IgG antibodies. To say the least, oligomerization is not a universal strategy to reduce the allergenic potency of Bet v 1 homologues, even though the published results on a Bet v 1 trimer18, 19, 20, 21 suggested this conclusion. In this study, IgE antibody reactivities as measured by EAST correlated well with the results of the analysis of the secondary structure by CD spectroscopy. Structurally intact, folded forms such as wild-type monomers, dimer, and trimer were IgE-reactive, whereas misfolded mutant monomers and dimer lost all or most of their IgE antibody binding capacity. Position and mutation must be carefully chosen. Mutations at position 112 mutating the amino acid present into a proline had been previously identified as critical for the overall folding of Bet v 1 and Bet v 1 homologues,12, 13, 14 and, second, oligomerization.18, 19, 20, 21 This mutation destroyed the secondary structures of Dau c 1 monomers and the dimer.

The studies published so far on the influence of mutation on structure and allergenic activity of Bet v 1 and its homologues did not result in clear-cut conclusions. It seemed difficult to preserve structure and reduce allergenic activity at the same time. To combine both in 1 molecule may be desirable for the development of a therapeutic reagent that is able to induce blocking antibodies to the correctly folded allergen, and, at the same time, has reduced IgE antibody binding capacity to avoid adverse reactions during SIT.

The study by Holm et al24 testing conformationally intact Bet v 1 mutants carrying 4 (N28T, K32Q, E45S, P108G) and 9 mutations (Y5V, E42S, E45S, N78K, K103V, K123I, K134E, D156H, +160N) did not show much reduction of IgE antibody binding capacity and allergenic activity as demonstrated by antibody binding and histamine release assays. The overall folding, however, remained intact. In 2 other studies,15, 16 the contribution of individual amino acid positions and residues for IgE binding capacity of the Dau c 1 homologous allergens Bet v 1 from birch pollen and Mal d 1 from apple were studied by site-directed mutagenesis. The authors described that the IgE antibody binding to Bet v 1 and Mal d 1 depended on at least 6 (T10P, F30V, S57N, S112C I113V, D125N) and 5 (T10P, I30V; T57N, T112C, I113Val) amino acid residues and/or positions, respectively. The mutants were correctly folded. Bolhaar et al10 demonstrated 5 mutations (T10P, I30V, T57N, T112C, I113V) introduced into Mal d 1, the Bet v 1 homolog from apple, resulted in a moderate decrease in IgE-binding potency. The allergenic activity determined by skin prick test and oral challenge, however, was significantly reduced. Wiche et al25 studied the Bet v 1 homolog from cherry, Pru av 1, demonstrating that if the folding of mutated allergen remained intact, the 2 mutations (N28K, P108A) reduced but did not abolish the allergenic potential of Pru av 1. All these studies taken together indicate that allergen variants carrying even multiple mutations may not be the ideal reagent for immunotherapy when the structure remains intact because the allergenic potency may not be completely abolished, even though these studies have increased our knowledge of the molecular basis of protein allergenicity. However, the risk that T-cell epitopes, which represent the therapeutic properties of an allergen vaccine, may be destroyed is minimized when the destruction of the allergen folding—and with it the majority of IgE antibody binding epitopes—can be achieved by only a few mutations.

The results presented here demonstrate that it may not be necessary to use a structurally intact allergen in its natural conformation to induce a strong response of blocking antibodies. The 112P mutants of Dau c 1.01 and Dau c 1.02 both induced antibodies that did not significantly differ from those induced by wild-type Dau c 1.01 and Dau c 1.02. Furthermore, the blocking antibodies raised against the mutant forms inhibited—as those antibodies raised against wild-type forms—IgE antibody binding to wild-type Dau c 1.01 and Dau c 1.02, indicating that at least a substantial portion of these antibodies also bound the native conformation of Dau c 1 and recognized areas also recognized by IgE. In this context, the question remains why immunizations with misfolded allergen give rise to antibodies that bind to native allergen. This may be explained (1) by the presence of a small amount of folded material in our preparations of mutated Dau c 1, or (2) by the presence of epitopes that are not affected by changes caused by the mutation at position 112. Even though the first alternative may not be entirely excluded, the second alternative seems more plausible. However, this hypothesis may be tested by comparing the epitopes recognized the murine sera raised against native and misfolded Dau c 1 as well as sera from patients who underwent (successful) immunotherapy. A suitable approach to compare in detail the epitopes recognized by our mouse sera with those of IgE from subjects with carrot allergy could be the use of phage-displayed peptide mimics, as recently described by Mittag et al.26

Another question is whether monomeric or oligomeric allergen is the better reagent for immunotherapy. On the basis of the results, the dimeric (mutant) Dau c 1 molecule should be preferred because dimerization had an enhancing effect on the immunogenicity, indicated by the fact that the lowest dose of the dimer produced a clearly higher antibody response compared with the identical dose of the mixture of monomers. In the particular dimer that combined the 2 isoforms of Dau c 1, Dau c 1.01 and Dau c 1.02, in 1 vaccine, an additional advantage combines the T-cell repertoire of both Dau c 1 isoforms. The results of the histamine release experiments, stimulating the human basophils from subjects with carrot allergy with Dau c 1.01 and Dau c 1.02 wild-type and mutant monomers and dimers and Dau c 1.01 trimer, further supported the notion that oligomerization did not reduce the allergenic potency of Dau c 1, whereas structurally altered monomers and dimers showed reduced biological activity.

In conclusion, wild-type monomers and dimer induced IgG antibodies to all Dau c 1 forms. The wild-type and mutant dimers were stronger immunogens than the monomers, because all doses induced specific antibodies to all Dau c 1 forms. Furthermore, all murine sera raised against Dau c 1 wild-type/mutant monomers/dimers contained antibodies specific for epitopes recognized by human IgE, indicating that even misfolded antigen gave rise to antibodies specific for conformational epitopes. In light of the results obtained in this study, destruction of the native conformation rather than oligomerization of wild-type allergens is the appropriate strategy for the development of novel reagents for classic allergen-SIT.

Back to Article Outline

 

We acknowledge Dr Kay Fötisch (Paul Ehrlich Institut, Langen, Germany) for conducting the histamine release experiments.

Back to Article Outline

Appendix. Supplementary data 

Download file

download text

Online Repository.

Back to Article Outline

References 

  1. Lin X, Hwang GJ, Zimmerman JL. Isolation and characterization of a diverse set of genes from carrot somatic embryos. Plant Physiol. 1996;112:1365–1374
  2. Ballmer-Weber BK, Wangorsch A, Bohle B, Kaul S, Kundig T, Fotisch K, et al. Component-resolved in vitro diagnosis in carrot allergy: does the use of recombinant carrot allergens improve the reliability of the diagnostic procedure?. Clin Exp Allergy. 2005;35:970–978
  3. Yamamoto M, Torikai S, Oeda K. A major root protein of carrots with high homology to intracellular pathogenesis-related (PR) proteins and pollen allergens. Plant Cell Physiol. 1997;38:1080–1086
  4. Hoffmann-Sommergruber K, O'Riordain G, Ahorn H, Ebner C, Laimer Da Camara Machado M, Puhringer H, et al. Molecular characterization of Dau c 1, the Bet v 1 homologous protein from carrot and its cross-reactivity with Bet v 1 and Api g 1. Clin Exp Allergy. 1999;29:840–847
  5. Vieths S, Scheurer S, Ballmer-Weber B. Current understanding of cross-reactivity of food allergens and pollen. Ann N Y Acad Sci. 2002;964:47–68
  6. Ballmer-Weber BK, Wuthrich B, Wangorsch A, Fotisch K, Altmann F, Vieths S. Carrot allergy: double-blinded, placebo-controlled food challenge and identification of allergens. J Allergy Clin Immunol. 2001;108:301–307
  7. Helbling A, Lopez M, Schwartz HJ, Lehrer SB. Reactivity of carrot-specific IgE antibodies with celery, apiaceous spices, and birch pollen. Ann Allergy. 1993;70:495–499
  8. Bohle B, Radakovics A, Luttkopf D, Jahn-Schmid B, Vieths S, Ebner C. Characterization of the T cell response to the major hazelnut allergen, Cor a 1.04: evidence for a relevant T cell epitope not cross-reactive with homologous pollen allergens. Clin Exp Allergy. 2005;35:1392–1399
  9. Hansen KS, Khinchi MS, Skov PS, Bindslev-Jensen C, Poulsen LK, Malling HJ. Food allergy to apple and specific immunotherapy with birch pollen. Mol Nutr Food Res. 2004;48:441–448
  10. Bolhaar ST, Tiemessen MM, Zuidmeer L, van Leeuwen A, Hoffman-Sommergruber K, Bruijnzeel-Koomen CA, et al. Efficacy of birch-pollen immunotherapy on cross-reactive food allergy confirmed by skin tests and double-blind food challenges. Clin Exp Allergy. 2004;34:761–769
  11. Bucher X, Pichler WJ, Dahinden CA, Helbling A. Effect of tree pollen specific, subcutaneous immunotherapy on the oral allergy syndrome to apple and hazelnut. Allergy. 2004;59:1272–1276
  12. Son DY, Scheurer S, Hoffmann A, Haustein D, Vieths S. Pollen-related food allergy: cloning and immunological analysis of isoforms and mutants of Mal d 1, the major apple allergen, and Bet v 1, the major birch pollen allergen. Eur J Nutr. 1999;38:201–215
  13. Scheurer S, Son DY, Boehm M, Karamloo F, Franke S, Hoffman A, et al. Cross-reactivity and epitope analysis of Pru a 1, the major cherry allergen. Mol Immunol. 1999;36:155–167
  14. Neudecker P, Lehmann K, Nerkamp J, Haase T, Wangorsch A, Fotisch K, et al. Mutational epitope analysis of Pru av 1 and Api g 1, the major allergens of cherry (Prunus avium) and celery (Apium graveolens): correlating IgE reactivity with three-dimensional structure. Biochem J. 2003;376:97–107
  15. Ferreira F, Ebner C, Kramer B, Casari G, Briza P, Kungl AJ, et al. Modulation of IgE reactivity of allergens by site-directed mutagenesis: potential use of hypoallergenic variants for immunotherapy. FASEB J. 1998;12:231–242
  16. Ma Y, Gadermaier G, Bohle B, Bolhaar S, Knulst A, Markovic-Housley Z, et al. Mutational analysis of amino acid positions crucial for IgE-binding epitopes of the major apple (Malus domestica) allergen, Mal d 1. Int Arch Allergy Immunol. 2006;139:53–62
  17. Vrtala S, Hirtenlehner K, Susani M, Akdis M, Kussebi F, Akdis CA, et al. Genetic engineering of a hypoallergenic trimer of the major birch pollen allergen Bet v 1. FASEB J. 2001;15:2045–2047
  18. Gafvelin G, Thunberg S, Kronqvist M, Gronlund H, Gronneberg R, Troye-Blomberg M, et al. Cytokine and antibody responses in birch-pollen-allergic patients treated with genetically modified derivatives of the major birch pollen allergen Bet v 1. Int Arch Allergy Immunol. 2005;138:59–66
  19. Mahler V, Vrtala S, Kuss O, Diepgen TL, Suck R, Cromwell O, et al. Vaccines for birch pollen allergy based on genetically engineered hypoallergenic derivatives of the major birch pollen allergen, Bet v 1. Clin Exp Allergy. 2004;34:115–122
  20. Niederberger V, Valenta R. Molecular approaches for new vaccines against allergy. Expert Rev Vaccines. 2006;5:103–110
  21. Reisinger J, Horak F, Pauli G, van Hage M, Cromwell O, Konig F, et al. Allergen-specific nasal IgG antibodies induced by vaccination with genetically modified allergens are associated with reduced nasal allergen sensitivity. J Allergy Clin Immunol. 2005;116:347–354
  22. Ceska M, Lundkvist U. A new and simple radioimmunoassay method for the determination of IgE. Immunochemistry. 1972;9:1021–1030
  23. Kwok SC, Hodges RS. Clustering of large hydrophobes in the hydrophobic core of two-stranded alpha-helical coiled-coils controls protein folding and stability. J Biol Chem. 2003;278:35248–35254
  24. Holm J, Gajhede M, Ferreras M, Henriksen A, Ipsen H, Larsen JN, et al. Allergy vaccine engineering: epitope modulation of recombinant Bet v 1 reduces IgE binding but retains protein folding pattern for induction of protective blocking-antibody responses. J Immunol. 2004;173:5258–5267
  25. Wiche R, Gubesch M, Konig H, Fotisch K, Hoffmann A, Wangorsch A, et al. Molecular basis of pollen-related food allergy: identification of a second cross-reactive IgE epitope on Pru av 1, the major cherry (Prunus avium) allergen. Biochem J. 2005;385:319–327
  26. Mittag D, Batori V, Neudecker P, Wiche R, Friis EP, Ballmer-Weber BK, et al. A novel approach for investigation of specific and cross-reactive IgE epitopes on Bet v 1 and homologous food allergens in individual patients. Mol Immunol. 2006;43:268–278

 Dr Barbara K. Ballmer-Weber was a recipient of a grant for the promotion of academic young people of the University of Zürich (Stiefel-Zangger-Stiftung) and of the Swiss National Foundation (32-66308.01).Disclosure of potential conflict of interest: The authors have declared that they have no conflict of interest.

PII: S0091-6749(06)03802-4

doi:10.1016/j.jaci.2006.11.699

The Journal of Allergy and Clinical Immunology
Volume 119, Issue 4 , Pages 944-951, April 2007