Class switch recombination to IgE in the bronchial mucosa of atopic and nonatopic patients with asthma

Article Outline

• Abstract
• Methods
  • Clinical protocol
  • RNA isolation and RT-PCR
  • Statistical analysis
• Results
  • ɛGLT expression in the bronchial mucosa
  • ɛCT expression in the bronchial mucosa
  • IgE heavy chain mRNA expression in the bronchial mucosa
  • AID mRNA expression in the bronchial mucosa
• Discussion
• Acknowledgment
• References
• Copyright

Background

Class switching from IgM/IgG/IgA to IgE is required for B cells to express IgE. This requires class switch recombination in the Ig heavy-chain gene locus. It is generally believed that class switch recombination occurs in lymphoid tissue, but it was recently shown that class switching to IgE occurs in the nasal mucosa in allergic rhinitis.

Objective

We aimed to determine whether class switching to IgE also occurs in the bronchial mucosa in asthma, and to look for possible differences/similarities between atopic and nonatopic asthma.

Methods

We have used RT-PCR to examine ɛ immunoglobulin heavy-chain germline gene transcripts (GLTs; ɛGLTs), ɛ circle transcripts (CTs; Iɛ-Cμ CT or Iɛ-Cγ CT), and mRNA encoding the heavy chain of IgE (ɛ mRNA) and activation-induced cytidine deaminase (AID) in bronchial biopsies from atopic patients with asthma, nonatopic patients with asthma, atopic controls without asthma, and nonatopic controls without asthma (10 subjects in each group).

Results

The ɛGLT and AID mRNA were detectable in the bronchial mucosa of subjects in all 4 groups. In contrast, Iɛ-Cμ CT, Iɛ-Cγ CT, and ɛ mRNA were detectable in the bronchial mucosa of the majority of both atopic and nonatopic patients with asthma, but rarely in the controls without asthma.

Conclusion

The bronchial mucosa is a site primed in all individuals for class switching to IgE, because of B-cell expression of ɛGLT and AID mRNA. However, it is only in patients with asthma, regardless of atopic status, that class switching to IgE occurs.

Clinical implications

Our findings reveal prospects for local targeting of the Ig class switch mechanism in the management of atopic and nonatopic asthma.

Key words: IgE, class switch recombination, asthma, mucosa

Abbreviations used: AA, Atopic patient with asthma, AC, Atopic control without asthma, AID, Activation-induced cytidine deaminase, CSR, Class switch recombination, CT, Circle transcript, GLT, Germline gene transcript, NA, Nonatopic patient with asthma, NC, Nonatopic control without asthma, SPT, Skin prick test, UK, United Kingdom

Asthma is a debilitating disease affecting one fifth of the population of the developed world. Severe asthma is a major cause of hospitalization and health care costs. In clinical practice, asthma is classified as atopic or nonatopic, according to the presence or absence of circulating IgE directed against local aeroallergens detected by skin prick test (SPT) or in vitro techniques (RAST or ELISA). These IgE antibodies interact with the high-affinity IgE receptor (FcɛRI) on mast cells, which may result in immediate hypersensitivity on allergen provocation and acute exacerbation of disease.¹

About one third of adult patients with asthma are classified as nonatopic.², ³ They tend to have more severe disease, often associated with chronic rhinosinusitis, but apart from their lack of acute reactivity to allergens, their disease is clinically similar.³, ⁴, ⁵

IgE is characterized by its ɛ heavy-chain. It is produced after heavy-chain switching in B cells from IgM, IgG, or IgA to IgE, which proceeds in 3 stages: germline gene transcription, DNA recombination within the heavy-chain locus producing ɛ circle transcripts (CTs), and synthesis of ɛ-chain mRNA that is translated into protein.¹ The switch to IgE is initiated by the cytokines IL-4 or IL-13, produced principally by T_H2 cells, which drive ɛ germline gene transcription.⁶, ⁷ IL-4 also increases the expression of activation-induced cytidine deaminase (AID),⁸ an enzyme required for class switch recombination (CSR).⁹ AID expression and CSR, well known to occur in the germinal centers of lymphoid tissue,¹⁰ have recently also been demonstrated within the nasal mucosa of patients with allergic rhinitis.¹¹, ¹², ¹³

Molecular immunopathological comparisons of bronchial biopsies from atopic and nonatopic patients with asthma have demonstrated conditions conducive to IgE switching (elevated IL-4 and IL-13), expression of ɛ germline gene transcripts (GLTs; ɛGLTs), and FcɛRI mRNA (suggestive of IgE synthesis because IgE upregulates its own receptor) in both groups of patients.¹, ¹⁴, ¹⁵, ¹⁶, ¹⁷, ¹⁸ In view of these data, we hypothesized that the environment of the bronchial mucosa induces B-cell IgE switching leading to IgE synthesis in patients with asthma, regardless of their atopic status.

To test the hypothesis that local CSR to IgE and IgE synthesis occurs in the bronchial mucosa of patients with asthma, we have performed RT-PCR to look for ɛGLTs, CTs (Iɛ-Cμ CT and Iɛ-Cγ CT), ɛ mRNA, and AID mRNA in bronchial biopsies from atopic and nonatopic patients with asthma and atopic and nonatopic controls without asthma.

Back to Article Outline

Methods 

Clinical protocol 

Bronchial biopsies were obtained at fiberoptic bronchoscopy from atopic patients with asthma (AAs), nonatopic patients with asthma (NAs), atopic controls without asthma (ACs), and nonatopic controls without asthma (NCs; n = 10 in each group). Asthma was defined as a clear history of relevant symptoms with either reversible airways obstruction (≥15% variability in the FEV₁ either spontaneously or after inhaled albuterol, 200 μg), and/or a histamine PC₂₀ provocation test result <8 mg/mL documented in the previous 6 months. Nonasthma was defined as a lifelong absence of symptoms, FEV₁ within the predicted range, and <5% reversible with bronchodilator. Atopy was defined as a positive SPT and RAST to 1 or more of a full range of common aeroallergens (house dust mite, mixed grasses, mixed trees, mixed molds, cat and dog dander). Nonatopy was defined as uniformly negative SPT (in the presence of appropriate controls) and RAST to the same aeroallergens. Five of 10 of the atopic and 4 of 10 of the nonatopic patients with asthma were taking inhaled corticosteroids, but none was taking systemic corticosteroids. Smokers and subjects with any chronic disease other than asthma or rhinitis were excluded. The characteristics of the study participants are shown in Table I.

Table I. Characteristics of study participants

Fiberoptic bronchoscopy was performed as previously described.¹⁷ Eight to 10 biopsies were obtained from first-generation or second-generation right middle or lower lobe bronchi. Any wheezing after the bronchoscopy was treated with additional albuterol as required. Nasal prongs were used to deliver supplementary oxygen. Oxygen saturation was monitored throughout the procedure.

The study was performed with the approval of the Guy's Hospital Ethics Committee and the patients' written informed consent.

RNA isolation and RT-PCR 

Total RNA was isolated from whole biopsies using the Qiagen RNA isolation kit (Qiagen, Crawley, United Kingdom [UK]) following the manufacturer's instructions. RNA was suspended in nuclease-free water and quantified by spectrophotometry at 260 nm. RNA was reverse transcribed to cDNA, and ɛGLT, CT, and AID mRNA were PCR-amplified as described elsewhere.¹³ Briefly, for RT-PCR, 2.5 μg total RNA was first denatured at 100°C for 2 minutes and then cooled on ice for 2 minutes before being added to a 20-μL reaction mix containing 5x First strand buffer (Invitrogen Ltd, Paisley, UK), 0.1 mol/L dithiothreitol, 10 mmol/L dNTP mix, oligo dT primer (0.5 μg/μL), 40 U/μL RNase OUT (Invitrogen), random d(N)₁₀ primers (2 μg/μL), and 200 U/μL Moloney Murine Leukemia Virus Reverse Transcriptase (Invitrogen Ltd, Paisley, UK). The reaction was incubated at 37°C for 10 minutes and 42°C for 40 minutes, with a final incubation of 10 minutes at 50°C. Finally, the cDNA reaction was diluted with 80 μL nuclease-free water and incubated at 100°C for 2 minutes. cDNA was stored at −20°C until further needed.

ɛ mRNA was amplified by seminested PCR using a forward primer in the variable-region of the heavy-chain (VH) and reverse primers in the heavy-chain of IgE. The first round of ɛ mRNA PCR was conducted in a 30-μL reaction containing 20 mmol/L Tris-HCl (pH 8.0), 100 mmol/L KCl, 0.1 mmol/L EDTA, 2.0 mmol/L MgCl₂, 10 mmol/L dNTP mix; 50 pmol/L each primer: forward primer VF2 (5′AGTCTGGAGCAGAGGTG3′) and reverse primer CɛR1 (5′CAGGACGACTGTAAGATCTTCACG3′); and 2.5U Taq polymerase (Promega Life Sciences, Southampton, UK). The first cycle was conducted at 94°C for 5 minutes, followed by 35 cycles at 94°C for 1 minute, 66°C for 1 minute and 72°C for 1.5 minute, and a final extension at 72°C for 5 minutes. A second round of PCR was performed on a 3-μL aliquot of the first-round PCR product under the same conditions as described, except that an inner CɛR2 reverse primer (5′GGGGTGAAGTCCCTGGAGC3′) and annealing temperature of 62°C were used. PCR amplification of mRNA isolated from tonsil B cells stimulated with IL-4 and anti-CD40 was used as positive control for ɛGLT and ɛCT PCR. cDNA from an IgE-expressing cell line (AF10) was used as a positive control for ɛ mRNA PCR. PCR amplification of cDNA from an AID-expressing cell line (RAMOS) was used as a positive control for AID mRNA. Nuclease-free water was substituted for cDNA in negative controls.

PCR products were cloned and sequenced to confirm their identity. The identities of ɛCT were further confirmed by Southern blot hybridization. This procedure has been described in detail previously.¹³ The results presented are representative of at least 3 reproducible independent PCR amplifications performed on each subject sample.

Statistical analysis 

The χ² test was used for comparison of marker frequencies in AA versus AC and NA versus NC. P values less than .05 were considered statistically significant.

Back to Article Outline

Results 

ɛGLT expression in the bronchial mucosa 

ɛ Germline transcription marks the first step in the commitment of B cells to the synthesis of IgE. We sought ɛGLT in bronchial mucosal biopsies from 10 patients in each of the 4 subject groups. As shown in Fig 1, A, and Table II, ɛGLT expression was detected in 8 of 10 AAs, 7 of 10 NAs, 5 of 10 ACs, and 1 of 10 NCs.

• 
  • View Large Image
  • Download to PowerPoint

• Fig 1. 

  Expression of ɛGLT in the bronchial mucosa. A, Distribution of ɛGLT (379 bp) in 10 subjects (1-10) representing AA, NA, AC, and NC. B, Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified to control cDNA loading. Lanes +C, −C, −C1, −C2, and L correspond to PCR-positive control, PCR-negative control, the first-and second-round PCR-negative controls, and 100-bp DNA ladder, respectively.

Table II. Distribution of εGLT, εCT, ε- and AID mRNA in the bronchial mucosa

	Patient no.
Markers	1	2	3	4	5	6	7	8	9	10	Total
AA
εGLT	•	•	•	•	•	•	•		•		8/10
Iε-Cμ CT		•	•		•	•			•		5/10
Iε-CγCT		•		•			•	•		•	5/10
ε mRNA	•	•	•			•	•	•	•	•	8/10
AID mRNA		•	•			•	•	•	•	•	7/10
NA
εGLT	•		•		•	•		•	•	•	7/10
Iε-Cμ CT		•				•	•	•		•	5/10
Iε-CγCT		•			•			•			3/10
ε mRNA	•	•	•	•	•	•		•	•		8/10
AID mRNA	•	•				•		•	•		5/10
AC
εGLT		•	•	•	•				•		5/10
Iε-Cμ CT											0/10
Iε-CγCT											0/10
ε mRNA				•		•					2/10
AID mRNA								•			1/10
NC
εGLT				•							1/10
Iε-Cμ CT											0/10
Iε-CγCT											0/10
ε mRNA					•						1/10
AID mRNA			•		•	•	•				4/10

ɛCT expression in the bronchial mucosa 

DNA recombination, producing ɛCT, marks the irreversible step in the commitment of B cells to the synthesis of IgE. We sought ɛCT in the same biopsies used to detect GLT. IgM to IgE (Iɛ-Cμ) CTs were detected in the bronchial biopsies from 5 of 10 AAs and 5 of 10 NAs (Fig 2, A). IgG to IgE (Iɛ-Cγ) CTs were amplified from biopsies from 5 of 10 AAs and 3 of 10 NAs (Fig 2, B). In biopsies from 1 AAs and 2 NAs, both Iɛ-Cμ CT and Iɛ-Cγ CT were detected together (Table II). In contrast, no CTs were observed in biopsies from any of the control subjects without asthma (data not shown). Overall, CTs (Iɛ-Cγ or Iɛ-Cμ) were observed in biopsies from 9 of 10 AAs compared with 0 of 10 ACs (P = .0001) and 6 of 10 NAs compared with 0 of 10 NCs (P = .01). To confirm their identity, PCR products from the positive biopsies were cloned and sequenced. The expected sequences were obtained in all cases (data not shown).

• 
  • View Large Image
  • Download to PowerPoint

• Fig 2. 

  Expression of ɛCT in the bronchial mucosa. PCR-amplified ɛCT products detected by agarose gel electrophoresis were probed with a radiolabeled probe (Iɛ) by Southern blotting.¹³ A and B, Distribution of Iɛ-Cμ CT and Iɛ-Cγ CT in atopic and nonatopic patients with asthma. Lanes 1-10 correspond to 10 patients in each group. Lane +C shows the PCR-positive control. Lanes −C1 and −C2 are the first-round and second-round PCR-negative controls.

IgE heavy chain mRNA expression in the bronchial mucosa 

IgE synthesis by B cells is the third and final step in the production of IgE. We observed ɛ mRNA in biopsies from 8 of 10 AAs compared with 2 of 10 ACs (P = .020) and 8 of 10 NAs compared with 1 of 10 NCs (P = .006; Fig 3, Table II). There was no correlation between serum IgE levels and presence or absence of ɛ mRNA in patients with asthma (data not shown).

• 
  • View Large Image
  • Download to PowerPoint

• Fig 3. 

  Expression of ɛ mRNA in the bronchial mucosa. ɛ mRNA was PCR-amplified from the bronchial mucosa of subjects with and without asthma. Lanes marked 1-10 represent 10 patients in each of the 4 groups. Lanes marked +C, −C1, −C2 and L are the PCR-positive control, first-round and second-round PCR-negative controls, and DNA ladder, respectively.

AID mRNA expression in the bronchial mucosa 

Activation-induced cytidine deaminase expression is required for CSR, and thus occurs in lymphoid tissue¹⁰ and has been observed in the nasal mucosa of patients with allergic rhinitis.¹², ¹³ We obtained a 335-bp band corresponding to the expected size of AID mRNA, the identity of which was confirmed by sequencing, in 7 of 10 AAs, 5 of 10 NAs, 1 of 10 ACs, and 4 of 10 NCs, as shown in Fig 4 and Table II. Like the presence ɛGLT, that of AID mRNA demonstrates that the bronchial mucosa is primed to undergo class switching to IgE, and that this is unrelated to atopic or asthmatic status.

• 
  • View Large Image
  • Download to PowerPoint

• Fig 4. 

  Expression of AID mRNA in the bronchial mucosa. AID mRNA was amplified by nested PCR reaction. Lanes 1-10 show 10 patients in each of the 4 experimental groups. Lane +C shows the PCR-positive control. Lanes −C1 and −C2 are the first-round and second-round PCR-negative controls. Lane L is the 100-bp DNA marker ladder.

Back to Article Outline

Discussion 

We have investigated B-cell IgE switching and synthesis in the bronchial mucosa of patients with asthma, and provide the first direct and definitive evidence that bronchial mucosal B cells undergo class switch recombination from IgM and IgG to IgE in situ. Our data would suggest that this phenomenon is a particular feature of asthma, and occurs irrespective of the atopic status of the patients with asthma as assigned by conventional SPT or in vitro testing to detect allergen-specific IgE. The expression of ɛCT is a marker of inevitable commitment of B cells to IgE synthesis and, unlike ɛGLT, cannot be uniquely identified by other techniques such as in situ hybridization. Our data show that B cells within the asthmatic bronchial mucosa undergo CSR from both IgM and/or IgG to IgE. A previous study also provided evidence for ɛCT production in the nasal mucosa of patients with allergic rhinitis.¹³ This propensity of B cells to undergo CSR in asthma is set against a background in which the bronchial mucosa appears to be generally conducive to Ig class switching.

We have demonstrated ɛGLT expression in mucosal B cells of patients with asthma and controls, consistent with a previous study,¹⁶ as well as expression of the enzyme AID, which is required for the process of CSR⁹ and which is more conventionally associated with the germinal centers of lymphoid tissue.¹⁰ This may reflect a general requirement for B cells to switch to production of Igs of classes other than IgM, such as IgE or IgA, at mucosal surfaces in the course of immune surveillance or defense against attack by microorganisms. The expression of ɛGLT and AID demonstrates that the bronchial mucosa is primed for class switching to IgE.

The mechanisms whereby AID is expressed at mucosal surfaces are not clear. Of relevance to asthma, AID expression is induced by IL-4,⁸ which is highly expressed in the bronchial mucosa of both atopic and nonatopic patients with asthma but is also detectable along with IL-13¹⁵ in controls without asthma.¹⁸ This low level of IL-4 production may nevertheless be sufficient to induce AID expression in normal controls. There were instances in which CT was expressed in the absence of AID; this could be explained by the threshold of AID detection. Clearly, additional as yet undefined regulatory mechanisms may also operate.

Our data also show evidence of mature ɛ heavy-chain mRNA production that occurs with significantly greater incidence in patients with asthma compared with subjects without asthma, regardless of atopic status. Again, this is confirmatory of an earlier study showing elevated Cɛ mRNA expression in atopic and nonatopic patients with asthma using in situ hybridization.¹⁶ It is reasonable to assume that this reflects ongoing, elevated synthesis of mature IgE in the asthmatic bronchial mucosa by local B cells. ɛ mRNA in occasional biopsies from subjects without asthma most likely originates from B cells already committed to IgE synthesis elsewhere. Local production of allergen-specific IgE has in addition been demonstrated directly in the nasal mucosa of the upper respiratory tract.¹⁹ Theoretical calculations¹ suggested that the rate of local IgE synthesis in the nasal mucosa greatly exceeds that required to saturate IgE receptors on local leukocytes such as mast cells. Thus, local IgE synthesis may well account for most, if not all, biologically significant IgE production, and circulating IgE may reflect spillover of IgE from mucosal sites, rather than passage of IgE or IgE producing B cells from more remote lymphoid tissue.

Mucosal production of IgE by B cells may be part of a wider process of clonal expansion of these cells locally within the mucosa of the respiratory tract. Evidence has previously been presented suggesting clonal expansion of B cells in the nasal¹² and bronchial mucosa.²⁰ There is similar evidence of IgE production by local germinal centers at other mucosal surfaces.²¹

Our data suggesting that CSR and bronchial mucosal IgE synthesis are features of atopic and nonatopic asthma add to the mounting evidence that atopic and nonatopic asthma are strikingly similar in terms of their cellular and molecular immunopathology.¹⁴, ¹⁵, ¹⁸ If it is assumed that a significant proportion of ongoing IgE synthesis derives from the bronchial mucosa of patients with asthma, then it is interesting to speculate why some have positive SPT and others do not. This may simply be a question of quantity, and that IgE spillover is not always detectable in the periphery. It is conceivable that all IgE synthesis is directed against as yet unknown allergens in nonatopic patients with asthma. A further possibility is that IgE is somehow sequestered within the mucosa in some patients, for instance, by autoantigens or commensal bacteria. Whatever the case, these data further narrow the gap between atopic and nonatopic asthma in terms of pathophysiology.

The clinical efficacy of monoclonal anti-IgE antibodies such as omalizumab in ameliorating some aspects of asthma²² supports the concept that ongoing IgE synthesis plays a significant role in determining asthma severity, but no study has demonstrated that removal of IgE that is directed specifically against aeroallergens is critical for this effect. Thus, regardless of the specificity of the IgE produced in nonatopic patients with asthma, anti-IgE therapy may well be efficacious for these patients.

Back to Article Outline

We thank Drs Ajitha Jayaratnam, Jonathan Ratoff, and David Simcock for assistance with biopsies. We are also grateful to Kheem Jones, Marianne Morgan, Kristen Jackson, and Cherylin Mitchell for recruiting patients for this study. We thank Kate Kirwan for assistance with the figures.

Back to Article Outline

References 

1. Gould HJ, Sutton BJ, Beavil AJ, Beavil RL, McCloskey N, Coker HA, et al. The biology of IgE and the basis of allergic disease. Annu Rev Immunol. 2003;21:579–628
   • View In Article
   • MEDLINE
   • CrossRef
2. Godard PH, Bousquet J, Michel F-B. Allergic and nonallergic asthma: still a matter for debate?. Clin Asthma Rev. 1997;1:19–22
   • View In Article
3. Corrigan C. Mechanisms of intrinsic asthma. Curr Opin Allergy Clin Immunol. 2004;4:53–56
   • View In Article
   • MEDLINE
   • CrossRef
4. Jayaratnam A, Corrigan CJ, Lee TH. The continuing enigma of non-atopic asthma. Clin Exp Allergy. 2005;35:835–837
   • View In Article
   • MEDLINE
   • CrossRef
5. Humbert M, Menz G, Ying S, Corrigan CJ, Robinson DS, Durham SR, et al. The immunopathology of extrinsic (atopic) and intrinsic (non-atopic) asthma: more similarities than differences. Immunol Today. 1999;20:528–533
   • View In Article
   • MEDLINE
   • CrossRef
6. Fear D, McCloskey N, O'Connor B, Felsenfeld G, Gould HJ. Transcription of Ig germline genes in single human B cells and the role of cytokines in isotype determination. J Immunol. 2004;173:4529–4538
   • View In Article
   • MEDLINE
7. Punnonen J, Aversa G, Cocks BG, Mckenzie ANJ, Menon S, Zurawski G, et al. Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc Natl Acad Sci U S A. 1993;90:3730–3734
   • View In Article
   • MEDLINE
   • CrossRef
8. Zhou C, Saxon A, Zhang K. Human activation-induced cytidine deaminase is induced by IL-4 and negatively regulated by CD45: implication of CD45 as a Janus kinase phosphatase in antibody diversification. J Immunol. 2003;170:1887–1893
   • View In Article
   • MEDLINE
9. Muramatsu M, Kinoshita K, Fagarasan S, Yamada S, Shinkai Y, Honjo T. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell. 2000;102:553–563
   • View In Article
   • MEDLINE
   • CrossRef
10. Muramatsu M, Sankaranand VS, Anant S, Sugai M, Kinoshita K, Davidson NO, et al. Specific expression of activation-induced cytidine deaminase (AID), a novel member of the RNA-editing deaminase family in germinal center B cells. J Biol Chem. 1999;274:18470–18476
    • View In Article
    • MEDLINE
    • CrossRef
11. Cameron L, Gounni AS, Frenkiel S, Lavigne F, Vercelli D, Hamid Q. SɛSμ and SɛSγ switch circles in human nasal mucosa following ex vivo allergen challenge: evidence for direct as well as sequential class switch recombination. J Immunol. 2003;171:3816–3822
    • View In Article
    • MEDLINE
12. Coker HA, Durham SR, Gould HJ. Local somatic hypermutation and class switch recombination in the nasal mucosa of allergic rhinitis patients. J Immunol. 2003;171:5602–5610
    • View In Article
    • MEDLINE
13. Takhar P, Smurthwaite L, Coker HA, Fear DJ, Banfield GK, Carr VA, et al. Allergen drives class switching to IgE in the nasal mucosa in allergic rhinitis. J Immunol. 2005;174:5024–5032
    • View In Article
    • MEDLINE
14. Humbert M, Durham SR, Ying S, Kimmit P, Barkans J, Assoufi B, et al. IL-4 and IL-5 mRNA and protein in bronchial biopsies from patients with atopic and nonatopic asthma: evidence against “intrinsic” asthma being a distinct immunopathologic entity. Am J Respir Crit Care Med. 1996;154:1497–1504
    • View In Article
    • MEDLINE
15. Humbert M, Durham SR, Kimmit P, Powell N, Assoufi B, Pfister R, et al. Elevated expression of messenger ribonucleic acid encoding IL-13 in the bronchial mucosa of atopic and nonatopic subjects with asthma. J Allergy Clin Immunol. 1997;99:657–665
    • View In Article
16. Ying S, Humbert M, Meng Q, Pfister R, Menz G, Gould HJ, et al. Local expression of ɛ germline gene transcripts and RNA for the ɛ heavy chain of IgE in the bronchial mucosa in atopic and nonatopic asthma. J Allergy Clin Immunol. 2001;107:686–692
    • View In Article
    • Abstract
    • Full Text
    • Full-Text PDF (125 KB)
    • CrossRef
17. Humbert M, Grant JA, Taborda-Barata L, Durham SR, Pfister R, Menz G, et al. High-affinity IgE receptor (FcɛRI)-bearing cells in bronchial biopsies from atopic and nonatopic asthma. Am J Respir Crit Care Med. 1996;153:1931–1937
    • View In Article
    • MEDLINE
18. Ying S, Humbert M, Barkans J, Corrigan CJ, Pfister R, Menz G, et al. Expression of IL-4 and IL-5 mRNA and protein product by CD4+ and CD8+ T cells, eosinophils, and mast cells in bronchial biopsies obtained from atopic and nonatopic (intrinsic) asthmatics. J Immunol. 1997;158:3539–3544
    • View In Article
    • MEDLINE
19. Smurthwaite L, Walker SN, Wilson DR, Birch DS, Merrett TG, Durham SR, et al. Persistent IgE synthesis in the nasal mucosa of hay fever patients. Eur J Immunol. 2001;31:3422–3431
    • View In Article
    • MEDLINE
    • CrossRef
20. Snow RE, Djukanovic R, Stevenson FK. Analysis of immunoglobulin E VH transcripts in a bronchial biopsy of an asthmatic patient confirms bias towards VH5, and indicates local clonal expansion, somatic mutation and isotype switch events. Immunology. 1999;98:646–651
    • View In Article
    • MEDLINE
    • CrossRef
21. Gould HJ, Takhar P, Harries HE, Durham SR, Corrigan CJ. Germinal-centre reactions in allergic inflammation. Trends Immunol. 2006;27:446–452
    • View In Article
    • MEDLINE
    • CrossRef
22. Holgate S, Casale T, Wenzel S, Bousquet J, Deniz Y, Reisner C. The anti-inflammatory effects of omalizumab confirm the central role of IgE in allergic inflammation. J Allergy Clin Immunol. 2005;115:459–465
    • View In Article
    • Abstract
    • Full Text
    • Full-Text PDF (274 KB)
    • CrossRef